Methods
Mice
C57BL/6J ( Jax 664), CD45.1 ( Jax 2014), μMT ( Jax 2288), Tcrb−/−Tcrd−/−
( Jax 2122), ChAT-IRES-Cre ( Jax 31661), CRH-IRES-Cre ( Jax 12704),
Rosa26-iDTR ( Jax 7900), Rosa26-Ai3 ( Jax 7903) and Rosa26-Ai14
(7914) mice were originally from the Jackson Laboratory and
maintained on a B6 background. Relevant mice were interbred to
obtain CRH-IRES-Cre:Rosa-Ai3, ChAT-IRES-Cre:Rosa26-iDTR and
ChAT-IRES-Cre:Ai14 mice. All mice were housed as groups of 4 to 6 indi-
viduals per cage and maintained on a 12-h light-dark cycle at 22–25°C
under specific-pathogen free conditions. All animal experiments were
approved by the Institutional Animal Care and Use Committee and con-
ducted in accordance of governmental and Tsinghua guidelines for ani-
mal welfare. When relevant and applicable, age- and sex-matched mice
were randomly chosen from same cages to be included in experimental
and control groups. The investigators were not blinded to allocation
during experiments and outcome assessment.
Construction of AChR-deficient mice
For germline ablation of the Chrna9, Chrnb4, and Chrnb1 genes in
B6 mice, the standard CRISPR–Cas9 technique was used. In brief,
for each gene, two sgRNAs targeting sequences coding for the trans-
membrane domain were co-injected together with Cas9-coding mRNA
into fertilized B6 eggs. Offspring were genotyped by sequencing to
identify mutants that cannot normally express the transmembrane
domain owing to either deletion of the coding sequence or introduc-
tion of premature stop codons. The chosen mutant founders were
then backcrossed with B6 mice for at least three generations before
subsequent experiments. The sgRNA sequences used were: Chrna9
GCGGAGCGAGGAACGATATG and GAGATGACGTTCTTCACGGC;
Chrnb4 TCACTGTCCTTCGACCCGGG and TTGTGTGCTCATCACGTCGC;
Chrnb1 ATGCATCCTCATCACGCTCC and CTAGGTTAATCCAACTTCCA.
The genotyping primers used were: 5′- GCAGTGCAACCTGACC
TTTG (Chrna9-F), 5′-ACGCCATCACAACTGCTACA (Chrna9-R),
5′-TTCCCTTCGACCAGCAGAAC (Chrna4-F), CACACAGTGGTGACG
ATGGA (Chrna4-R). Also see Extended Data Fig. 3 for details.
Construction of mixed bone-marrow chimaeras
Sex-matched B6 recipient mice were lethally irradiated by X-ray (6 Gy,
twice) and then intravenously infused with a combination of 4 × 10^6
bone-marrow cells of the indicated genotypes. Chimeras were given
antibiotics in drinking water for the first 2 weeks and used for experi-
ments 8 weeks after reconstitution.
Adoptive transfer and reconstitution of mice deficient in T or B
cells
CD4+ T cells and CD19+ B cells were isolated using a CD4 T cell isolation
kit and CD19 Microbeads (Miltenyi Biotec), respectively, according to
the manufacturer’s protocols. A total of 4 × 10^6 CD4+ T cells or 1.5 × 10^7
B cells of the indicated genotypes were intravenously infused into
Tcrb−/−Tcrd−/− mice or μMT mice, respectively, to create animals with
a CD4 or B cell compartment of the desired genotype. Five days after
the transfer, mice were used for experiments as indicated.
Splenic denervation
Three-week-old male B6 mice were anaesthetized with 75 mg/kg
sodium pentobarbital. The peritoneal cavity was accessed through
a midline abdominal incision. Forceps were used to blunt-isolate
the spleen away from the peritoneal cavity so that the three main
supplying vasculature trees were clearly exposed (Extended Data
Fig. 1a). With the peritoneal cavity and other organs protected with
a moistened cotton pad (Extended Data Fig. 1a), under a dissection
microscope, absolute ethanol was repeatedly applied with cotton tips
to those vasculature trees for 5–10 s each time, at 5-s intervals, and
about seven times in total in order to deplete the splenic nerve fibres
that run along them (Extended Data Fig. 1c). Care was taken to avoid
excessive ethanol dripping from the cotton tip and to avoid causing
visible vessel spasms, which could lead to permanent damage to blood
vessels and cause splenic necrosis and complete organ absorption.
For sham-operated mice, the entire surgical operation was identical
except that saline (pH 7.4) instead of absolute ethanol was repeatedly
applied. After denervation surgery, animals were allowed to recover
for 6 weeks before immunization and other experiments. Disappear-
ance of splenic innervation was histologically verifiable a week after
the surgery (Extended Data Fig. 1f, g).Immunization
To measure adaptive immune responses, mice of indicated types and
treatments were intraperitoneally injected with 100 μg NP-KLH or 60
μg NP-Ficoll (Biosearch Technologies) mixed with 1 μg LPS (Sigma) in
alum (Thermo Scientific).Acetylcholine and norepinephrine treatment
For certain experiments, noradrenaline bitartrate monohydrate or
acetylcholine chloride (Sigma) or the vehicle phosphate buffer saline
(pH 7.4) was injected subcutaneously in a volume of 100 μl twice daily,
10 h apart, at indicated concentrations during days 8–12 after immu-
nization.Retroviral transduction of B cells and neurotransmitter tests
The coding sequence of mouse AchE (NCBI: 11423) or COMT (NCBI:
12846) was inserted into multiple clone sites of a pBMN-PIB retrovi-
ral vector, upstream of an internal ribosomal entry site (IRES) and
enhanced green fluorescent protein. Cultures of Plat-E packaging cell
line were transfected with these constructs, and supernatants contain-
ing retrovirus were collected for transduction. B cells were isolated
using CD19 Microbeads (Miltenyi Biotec) and activated with 1 μg/ml
LPS (Sigma) for 1 day before being spin-infected with retroviral super-
natants at 1,500g for 2 h, as previously described^18. A total of 4 × 10^6
AchE- or COMT-transduced CD45.1 B cells was intravenously transferred
into B6 mice that had already been immunized with NP-KLH, once on
day 7 and one more time on day 9 after immunization.Flow cytometry
Single-cell suspensions of spleen or bone marrow were incubated in
MACS buffer (PBS supplemented with 1% FBS and 5 mM EDTA) contain-
ing 20 μg ml−1 2.4G2 antibody (BioXcell) for 20 min and then stained
with the indicated antibodies. Staining reagents included APC-Cy7
anti-CD19 (1D3), AF700 or BV421 anti-CD4 (GK1.5), PE anti-CD8 (53-
6.7), Af700 anti-CD3 (17A2), Af700 anti-CD11c (HL3), biotin-CD43
(S7), PE anti-CD19 (6D5), AF700 or APC-cy7 anti-B220 (RA3-6B2),
PE-Cy7 anti-CD93 (A4.1), FITC anti-CD23 (B3B4), APC anti-CD21
(7E9), PE-Cy7 anti-Fas ( Jo2), FITC or APC anti-GL7 (GL-7), BV510 or PE
or PE-Cy7 anti-CD138 (281-2), EF450 anti-IgM (EB121-15F9), APC and
FITC anti-IgM (ll/41), BV421 anti-IgM (eB121-15F9), percpcy5.5 anti-IgD
(11-26c.2a), EF450 anti-IgD (11-26C), FITC anti-IgG (poly4053), Pacific
Blue anti-CD45.1 (A20), APC-Cy7 anti-CD45.2 (104), V450 anti-Gr1
(RB6-8C5), APC streptavidin (Biolegend) and EF450 Streptavidin
(eBioscience). NP-PE (Biosearch Technologies) and Fixation/Per-
meabilization kit (554714, BD) were used for intracellular staining
of NP-binding plasma cells. CaspGLOW Fluorescein Active Caspase
Staining Kit (K180-100, Biovision) was used to detect apoptosis of
CD4+ and CD19+ cells ex vivo. Cells were typically stained on ice with
primary reagents for 30–60 min followed by staining with secondary
reagents for 30 min. Data were collected on an LSR II cytometer (BD)
and analysed with FlowJo software (TreeStar). Where applicable, cell
sorting was conducted with Aria IV (BD). Dead cells and cell aggregates
were excluded from analyses by 7-AAD staining (Biotium) and FSC-H/
FSC-A characteristics.