Article
Immunohistochemistry
For spleen immunohistochemistry, all samples were fixed in 4% para-
formaldehyde, embedded in OCT compound (Tissue-Tek), and kept at
−20 °C until further processing. Spleen slices (40 to 50 μm in thickness)
were cut using a microtome (Leica), blocked with PBS containing 0.3%
Triton X-100 and 3% FBS for 30 min at room temperature, and then
incubated with primary antibodies at appropriate final dilutions in a
humidified chamber at 4 °C overnight. Primary antibodies included
anti-tyrosine hydroxylase (AB152, Millipore; 1:400), EF450 anti-IgD
(1:100), EF660 anti-CD3ε (17A2, BD; 1:100), and goat-anti-Igκ (1050-
01, Southern Biotech; 1:400). After staining with primary antibodies,
the tissue slices were washed three times in washing buffer (PBS, 0.3%
Triton X-100) and incubated with AF488 donkey anti-rabbit (A21206,
Life Technology; 1:400) and AF647 donkey anti-goat (A21447, Life Tech-
nology; 1:400) for 30 min. After washing, the tissue slices were dried,
mounted with ProlongGold (Invitrogen) and examined using a Nikon
A1Rsi confocal microscope. Images were analysed using the Imaris
software package (Bitplane).
Measurement of splenic norepinephrine levels by ELISA
Spleens of sham-operated or denervated mice were weighed and then
cut into small pieces of approximately 1 mm^3. Tissue fragments were
incubated in ice-cold PBS containing 1% EDTA and shaken at 100 rpm
in a 35-mm dish on a shaker for 15 min. Norepinephrine in superna-
tants was then measured using the Norepinephrine ELISA kit (KA1877,
Abnova) according to the manufacturer’s instruction, and the final
results were presented as spleen weight-normalized norepinephrine
mass concentration.
Measurement of serum NP-specific IgG by ELISA
Sera were harvested from relevant mice and frozen until testing. A
96-well ELISA plate (42592, Costar) was coated with NP 23 -BSA (Biose-
arch Technologies) in PBS overnight and washed. A serial 1:2 dilution
of each serum sample, starting from 1:800, was then loaded into the
plate and incubated at 37 °C for 1 h. After washings, the plate was fur-
ther incubated with HRP-conjugated goat anti-mouse IgG (poly4053,
Biolegend) at 1:20,000 for 1 h before development with TMB Substrate
Set (421101, Biolegend). The chromogenic reaction was stopped with
1 M HCL, and optical density (OD) was read on an iMark plate reader. For
each group of animals, the resulting dilution curves were fit with the
3-parameter dose–response curve in Prism (Graphpad). Curves from
two groups in comparison were analysed by the extra sum-of-squares
F-test, and their nominal EC 50 s were used to calculate fold-change in
NP-specific IgG titres.
Synthesis of ACh analogue and detection of surface ACh binding
Our choice of the synthetic acetylcholine (ACh) analogue for
detecting acetylcholine receptors (2-(2-azidoacetoxy)-N,N,N-tr
imethylethan-1-aminium bromide, see Extended Data Fig. 3g for reac-
tion scheme) was based on the structure of the agonist–M2 receptor
complex^19. In brief, to a solution of 2-azidoacetic acid I (500 mg, 1.0
equiv, 4.95 mmol) in dichloromethane (7 ml) was added a few drops
of DMF under argon. After the addition of oxalyl dichloride (796 μl, 1.9
equiv, 9.41 mmol) was complete at 0 °C, the reaction mixture was stirred
for a further 5 min at the same temperature. Then the reaction mixture
was warmed to room temperature and stirred for another 3 h. After the
solvent and other volatile components had evaporated, the resulting
material was dissolved in dichloromethane (7 ml). To this mixture was
added 2-bromoethan-1-ol (182 μl, 0.52 equiv, 2.57 mmol) and pyridine
(588 μl, 1.48 equiv, 1.41 mmol) at 0 °C. After being stirred at 0 °C for 5
min, the reaction mixture was warmed to room temperature and stirred
for another 1 h. Then the organic layer was separated, and the aqueous
solution was extracted with dichloromethane. The combined organic
layer was washed with saturated aq.NaHCO 3 brine, dried over Na 2 SO 4
and concentrated in vacuo. The crude residue was purified through
silica gel chromatography (1:10 ether:hexanes) to give 201.5 mg (38%)
of II as oil. To a 25 ml flame-dried round flask was added c (80 mg, 1.0
equiv, 0.38 mmol) and toluene (5 ml). Then a solution of trimethylamine
in ethanol (1.2 ml, 3.2 M) was added by syringe. After being stirred at
90 °C for 5 h, the reaction mixture was cooled to room temperature.
The precipitate was collected by filtration and washed with toluene
and dichloromethane to obtain 44.3 mg (43%) of III as solid.^1 H NMR
(400 MHz, CD 3 OD) δ 4.70–4.62 (m, 2 H), 4.01 (s, 2 H), 3.82–4.76 (m, 2
H), 3.24 (s, 9 H);^13 C NMR (100 MHz, CD 3 OD) δ 169.5, 65.9, 59.9, 54.5, 51.1;
MS(ESI) m/z calculated for [M-Br]+ 187.12, found 187.25.
To detect acetylcholine-binding cells, a single-cell suspension was
blocked in MACS buffer containing 20 μg ml−1 2.4G2 antibody (BioXcell)
for 20 min and then incubated with the chemical III (1:200) on ice for 1.5
h. After being washed four times, these cells were incubated at room
temperature with 50 μM of DBCO-biotin in PBS containing 1% FBS in the
dark for 30 min. After being washed four times, the cells were stained on
ice for 30 min with 1 μg/ml EF450 streptavidin (eBioscience) together
with other antibodies for surface phenotyping.Survey detection of AChRs by RT–PCR
Total RNA was extracted from sorted splenic CD138+B220low SPPCs,
total B cells or Fas+GL7+ GC cells using the RNeasy PLUS Mini/Micro Kit
(Qiagen) and cDNA was prepared using RevertAid First Strand cDNA
Synthesis Kit (Thermo Fisher). The primers used for various receptors
(Invitrogen) are listed in Supplementary Table 3. Bands of expected
sizes from electrophoresis gels were used to retrieve DNA for sequenc-
ing verification of the amplicon identities.Quantitative real-time RT–PCR analysis for ChAT expression in
T cells
CD4 T cells from ChAT-IRES-Cre:Rosa26-Ai14 mice were transferred
into Tcrb−/−Tcrd−/− mice and immunized as described above. On day 8,
CD4 T cells from these mice were isolated using a CD4 T cell solation kit
(Miltenyi Biotec) according to the manufacturer’s protocol. These cells
were further sorted into ChAT-Ai14+ and ChAT-Ai14− fractions. Sorted
ChAT-Ai14+ and ChAT-Ai14− CD4 T cells were lysed in hypotonic lysis
buffer (Amresco, M334) at 72 °C for 3 min. Smart-seq2 reverse tran-
scription was then conducted. After pre-amplification and purification
with AMPure XP beads, cDNA was used for qPCR. qPCR was performed
using TB Green Premix EX Taq (RR420A, TaKaRa), and primer sequences
were as follows: Chat forward 5′-AGGGCAGCCTCTCTGTATGA-3′;
Chat reverse 5′- ATCCTCGTTGGACGCCATTT-3′; Gapdh forward
5′-CAAGGTCATCCATGACAACTTTG-3′; Gapdh reverse 5′- GTCCACCAC
CCTGTTGCTGTAG-3′.Mutation analysis of VH186.2-carrying SPPCs
To analyse the heavy-chain sequences of NP-specific SPPCs, CD138+ cells
were isolated 13 days after NP-KLH immunization. After incubation of
cells in lysis buffer at 60 °C for 5 min, reverse transcription was carried
out using Superscript cDNA Synthesis Kit (Invitrogen) according to the
manufacturer’s protocol. VH186.2 was amplified by nested PCR with
the following primers (first primer: 5 '- CTCTTCTTGGCAGCAACAGC
-3′, first antisense primer: 5 '- GCTGCTCAGAGTGTAGAGGTC -3′, sec-
ond primer: 5 '- GTGTCCACTCCCAGGTCCAAC -3′, second antisense
primer: 5 '- GTTCCAGGTCACTGTCACTG -3′). PCR products (400 bp)
were purified by gel electrophoresis, cloned into a T vector (Takara) and
sequenced. Mutations were identified by comparing these sequences
to the germline VH186.2 sequence, and only non-identical sequences
were counted as clones.Stereotactic viral microinjection to PVN and CeA
AAV vectors containing the DIO-taCaspase3 and DIO-GCaMP6m
constructs were packaged into an AAV2/9 serotype to achieve the
indicated infectious units per ml in the laboratory of Minmin Luo