122 ❯ STEP 4. Review the Knowledge You Need to Score Highproteins that it encodes. DNA must first be transcribed into an intermediary: mRNA. This
process is called transcription(Figure 11.5) because both DNA and RNA are built from
nucleotides—they speak a similar language. DNA acts as a template for mRNA, which then
conveys to the ribosomes the blueprints for producing the protein of interest. Transcription
occurs in the nucleus.
Transcription consists of three steps: initiation, elongation, and termination. The
process begins when RNA polymeraseattaches to the promoter region of a DNA strand
(initiation). A promoter regionis simply a recognition site that shows the polymerase where
transcription should begin. The promoter region contains a group of nucleotides known as
theTATA box,which is important to the binding of RNA polymerase. As in DNA replica-
tion, the polymerase of transcription needs the assistance of helper proteins to find and
attach to the promoter region. These helpers are called transcription factors.Once bound,
the RNA polymerase works its magic by adding the appropriate RNA nucleotide to the 3′
end of the growing strand (elongation). Like DNA polymerase of replication, RNA poly-
merase adds nucleotides 5′to 3′. The growing mRNA strand separates from the DNA as it
grows longer. A region called the termination sitetells the polymerase when transcription
should conclude (termination). After reaching this site, the mRNA is released and set free.RNA Processing
In bacteria, mRNA is ready to rock immediately after it is released from the DNA. In
eukaryotes, this is not the case. The mRNA produced after transcription must be modified
before it can leave the nucleus and lead the formation of proteins on the ribosomes. The 5′
and the 3′ends of the newly produced mRNA molecule are touched up. The 5′end is given
a guanine cap, which serves to protect the RNA and also helps in attachment to the ribo-
some later on. The 3′end is given something called a polyadenine tail,which may help ease
the movement from the nucleus to the cytoplasm. Along with these changes, the introns
(noncoding regions produced during transcription) are cut out of the mRNA, and the
remainingexons(coding regions) are glued back together to produce the mRNA that is
translated into a protein. This is called RNA splicing.We admit that it does seem strange
and inefficient that the DNA would contain so many regions that are not used in the pro-
duction of the gene, but perhaps there is method to the madness. It is hypothesized that
introns exist to provide flexibility to the genome. They could allow an organism to make
different proteins from the same gene; the only difference is which introns get spliced out
from one to the other. It is also possible that this whole splicing process plays a role in
allowing the movement of mRNA from the nucleus to the cytoplasm.3 ′GTCATCGTATATACTGTGTACGTAGATCGTAGCTAGCCTGATCGATCGAGTGTCGATGCTATCTGATA 5′Promoter termination siteRNA polymeraseFigure 11.5 Transcription.BIG IDEA 3.B.1
Gene regulation
results in differen-
tial gene expres-
sion, leading to cell
specialization.