Methods
Data reporting
No statistical methods were used to predetermine sample size. The
experiments were not randomized and the investigators were not
blinded to allocation during experiments and outcome assessment.
Cells
Vero 76, Vero 76 stably expressing TMPRSS2 (both used for pseudotype
experiments)^4 , the Vero 76 subclone Vero E6 (used for SARS-CoV-2
experiments), HEK293T and Calu-3 cells^16 were cultured in Dulbecco’s
modified Eagle’s medium (DMEM) or minimum essential medium
(MEM, Calu-3) supplemented with 10% fetal bovine serum (FBS) and
1% penicillin–streptomycin. In case of Calu-3 cells, the medium was
also supplemented with 1% non-essential amino acids and 1% sodium
pyruvate. All cell lines were incubated at 37 °C and 5% CO 2 and were
obtained from repositories (Vero E6 and HEK293T) or collaborators
(Calu-3 and Vero 76). Cell lines were free of mycoplasma, authenticated
on the basis of morphology and growth properties and confirmed by
PCR to be of the correct species. The cell lines used were not listed as
commonly misidentified cell lines by the ICLAC register.
Production of pseudotyped particles
Vesicular stomatitis virus (VSV) particles pseudotyped with SARS-CoV-2
S were generated according to published protocols^4 ,^17. At 24 h after
transfection, HEK293T cells expressing the S protein were inoculated
with a replication-restricted, VSV-G-trans-complemented VSV, which
lacks the genetic information for VSV-G but instead encodes the
reporter genes eGFP (enhanced green fluorescent protein) and FLuc
(firefly luciferase), VSV*ΔG-FLuc^18 (provided by G. Zimmer). After 1 h
of incubation at 37 °C and 5% CO 2 , the inoculum was aspirated and the
cells were washed with phosphate-buffered saline (PBS) before culture
medium was added. The culture medium was further supplemented
with the culture supernatant from I1-hybridoma cells (CRL-2700 cells,
ATCC) containing anti-VSV-G antibody (1:1,000) to inactivate residual
input virus. After an incubation period of 18 h at 37 °C and 5% CO 2 , the
culture supernatant was collected, centrifuged to pellet cellular debris,
and the clarified supernatant was aliquoted and stored at −80 °C until
further use.
Transduction of target cells with pseudotypes and its inhibition
For transduction experiments, Vero, TMPRSS2-expressing Vero
and Calu-3 cells were grown in 96-well plates and allowed to reach
about 50–70% confluency. Then, cells were preincubated with medium
containing different concentrations (10 nM, 100 nM, 1 μM, 10 μM or
100 μM) of camostat mesylate (Sigma-Aldrich), chloroquine or hydroxy-
chloroquine (both Tocris) or DMSO (Roth, solvent control) for 2 h at
37 °C and 5% CO 2 , before they were inoculated with S-bearing VSV. At
18 h after transduction, culture supernatants were aspirated and cells
were lysed by incubation (30 min, room temperature) with Cell Culture
Lysis Reagent (Promega). Cell lysates were subsequently transferred to
white, opaque-walled 96-well plates and FLuc activity was quantified as
an indicator of transduction efficiency, using the Beetle-Juice substrate
(PJK) and a Hidex Sense plate reader (Hidex) operated with Hidex plate
reader software (version 0.5.41.0, Hidex). Raw luminescence values
(indicating luciferase activity) were recorded as counts per second.
For normalization, transduction of DMSO-treated cells was set to 100%
and the relative transduction efficiencies in the presence of camostat
mesylate, chloroquine or hydroxychloroquine were calculated. Trans-
duction experiments were performed in technical quadruplicates using
three separate pseudotype preparations.
SARS-CoV-2 infection of target cells and its inhibition
Virus infections were done with SARS-CoV-2 Munich isolate 929. Vero E6
or Calu-3 cells were seeded at densities of 3.5 × 10^5 cells per ml or 6 × 10^5
cells per ml in 12-well plates, respectively. After 24 h, cells were incu-
bated with chloroquine (1 μM, 10 μM or 100 μM) or left untreated (con-
trol) for 1 h at 37 °C. Subsequently, cells were infected with an MOI of
0.001 in serum-free OPTIpro medium containing the above-mentioned
chloroquine concentrations at 4 °C for 30 min to enable virus attach-
ment. Afterwards, infection medium was removed and the wells were
washed twice with PBS and DMEM supplemented with chloroquine
was added as described above and the plates were incubated at 37 °C.
Samples were taken at 24 h after infection. Infection experiments were
conducted with biological triplicates in a biosafety level 3 laboratory.Viral RNA extraction and quantitative RT–PCR
For viral RNA extraction from supernatants, 50 μl of cell culture superna-
tant was mixed with RAV1 lysis buffer (Macherey-Nagel) followed by an
incubation at 70 °C for 10 min. RNA extraction was performed as recom-
mended by the manufacturer (Macherey-Nagel). For intracellular viral
RNA extraction, cells were washed with PBS and lysed with TRIzol (Zymo).
SARS-CoV-2 genome equivalents were detected by quantitative RT–PCR
targeting the SARS-CoV-2 E gene as previously reported^19 , using the
following primers: E_Sarbeco_F, ACAGGTACGTTAATAGTTAATAGCGT;
E_Sarbeco_P1, FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ;
E_Sarbeco_R, ATATTGCAGCAGTACGCACACA. The quantitative RT–PCR
experiment and data processing were carried out using the LightCy-
cler 480 Real-Time PCR System (Roche) and LightCycler 480 Software
(version 1.5, Roche Molecular Systems). Absolute quantification was
performed using SARS-CoV-2-specific in vitro-transcribed RNA stand-
ards, as previously described^19.Plaque assay
Infectious SARS-CoV-2 plaque-forming units were quantified by plaque
titration on Vero E6 cells, as previously described^20 , with minor modi-
fications. Vero E6 monolayers were seeded in 24-well plates, washed
with PBS, incubated with serial dilutions of SARS-CoV-2-containing
cell culture supernatants in duplicates, and overlaid with 1.2% Avicel in
DMEM, supplemented as described above. After 72 h, cells were fixed
with 6% formaline and visualized by crystal violet staining.Cell viability assay
The cell viability was quantified using the CellTiter-Glo assay (Promega)
and using the same experimental conditions as described above for
transduction experiments with the exception that cells were not inocu-
lated with virus particles. In brief, cells were preincubated for 2 h at 37 °C
and 5% CO 2 with medium containing different concentrations (10 nM,
100 nM, 1 μM, 10 μM or 100 μM) of camostat mesylate, chloroquine
or hydroxychloroquine, or DMSO (solvent control), before culture
medium was added (instead of medium containing VSV pseudotyped
with SARS-CoV-2 S) and cells were further incubated for 18 h. Next, intra-
cellular ATP levels were quantified as an indicator of cell viability. For
this, culture supernatants were aspirated and cells were lysed by incuba-
tion with CellTiter-Glo substrate for 30 min at room temperature. Cell
lysates were subsequently transferred to white, opaque-walled 96-well
plates and luminescence was measured using a Hidex Sense plate reader
(Hidex). Luminescence values (indicating cell viability) were recorded as
absolute counts over a period of 200 ms per well. For normalization, cell
viability of control-treated cells was set to 100% and the relative viability
of cells incubated in the presence of camostat mesylate, chloroquine
or hydroxychloroquine was calculated. Cell viability experiments were
performed in technical quadruplicates and repeated with three sepa-
rately prepared dilution series of the inhibitors.Statistical analysis
Two-way ANOVA with Dunnett’s post hoc test was performed to ana-
lyse statistical significance of differences in transduction efficien-
cies, SARS-CoV-2 genome equivalents or SARS-CoV-2 titres between
control- and inhibitor-treated cells. P > 0.05, not significant; *P ≤ 0.05;