Microsoft Word - blank.doc

674 Chapter 20 NEL

Termination

Eventually, the ribosome reaches one of the three stop codons: UGA, UAG, or UAA.

Since these three codons do not code for an amino acid, there are no corresponding

tRNAs. A protein known as a release factor recognizes that the ribosome has stalled and

helps release the polypeptide chain from the ribosome. As shown in Figure 9 (f ), on the

previous page, the two subunits of the ribosome now fall off the mRNA and transla-

tion stops.

Purpose Design Analysis

Problem Materials Evaluation

Hypothesis Procedure Synthesis

Prediction Evidence

Synthesis of a Protein

In this activity, you are provided with a DNA nucleotide

sequence that codes for a hypothetical protein. The code is

given in three fragments. This DNA code is from a eukary-

otic cell so in the mRNA transcript there are extra codons

called introns. Eukaryotic cells cut these sequences out of the

mRNA before it leaves the nucleus, so the codons are tran-

scribed but are not translated.

In this exercise, you will transcribe the three pieces of DNA

code into mRNA and identify the beginning fragment, the

middle fragment, and the end fragment. In addition, you will

remove the intron segment and translate the mRNA into the

protein.

Procedure

1. Copy each of the following sequences onto a separate
   piece of paper. (Hint:Turn your paper so you can
   write the sequence out along the horizontal length of
   the paper. Leave room below each sequence to write
   your mRNA sequence directly below.)

Sequence A

CTCGCGCCGAAACTTCCCTCCTAAACGTTCAAC

CGGTTCTTAATCCGCCGCCAGGGCCCC

Sequence B

CGTAACAACTTGTTACAACATGGTCATAAACGTCA

GATGGTCAATCTCTTAATGACT

Sequence C

TACAAACATGTAAACACACCCTCAGTGGACCAA

CTCCGCAACATAAACCAAACACCG

2. Divide the sequences into triplets (codons) by putting
   a slash between each group of three bases.


3. Transcribe the DNA into mRNA.
   4. Identify the middle, end, and beginning sequence.
   Use your knowledge of start and stop codons to help
   you figure it out. (Hint: You will need to examine the
   codons that start and end a fragment.)


4. Remove codons 24 to 51, including codon 51. These
   codons are the intron, or extra codons, found in this
   DNA segment.


5. Translate the mRNA into protein using the genetic
   code.

Analysis

(a) Which fragment was the beginning fragment?

How do you know?

(b) Which fragment was the end fragment? How do you

know?

(c) Codons 24 to 51 represent an intron. If the introns

were not cut out of the mRNA before it leaves the

nucleus and attaches to a ribosome, what would

happen to the protein structure? Is it likely that this

protein would still perform the same function?

Explain your answer.

(d) How many amino acids does this protein contain?

(e) Is this genetic sequence eukaryotic or prokaryotic?

How do you know?

(f ) If you worked backward, starting with the amino

acid sequence of the protein, would you obtain the

same DNA nucleotide sequence? Why or why not?

(g) Provide the anticodon sequence that would build this

protein.

LAB EXERCISE 20.A Report Checklist