188 ■ CHAPTER 10 How Genes Work
(^10) Which amino acid sequence will be generated during
translation from the following small mRNA: ...CCC-AUG-UCU-
UCG-UUA-UGA-UUG...? (Hint: Remember where translation starts
and stops.)
(a) Met-Glu-Arg-Arg-Glu-Leu
(b) Met-Ser-Ser-Leu-Leu
(c) Pro-Met-Ser-Ser-Leu-Leu
(d) Pro-Met-Ser-Ser-Leu
(e) Met-Ser-Ser-Leu
Tr y Something New
(^11) Some diseases (for example, Huntington’s and Parkinson’s)
appear to be related to increasing protein levels in brain cells,
which lead eventually to cell death. At which of the control points
shown in Figure 10.11 might a gene regulation error be occurring
with these diseases? Identify one control point at which the error
would result in up-regulation of gene expression, and one control
point at which the error would result in down-regulation of gene
expression.
(^12) The following nucleic acid is an entire primary transcript
(pre-mRNA not yet processed): ACGCAUGCGaugaugccccucag
GUCUguuuccgugaUGCCGUUGACCUGA. The nucleotides in
capitals are exons; and the nucleotides in lowercase type are
introns. Appropriately splice this primary transcript.
(a) ACGCAUGCGGUCUUGCCGUUGACCUGA
(b) augccuuucagguuuccguga
(c) augccuuucagGUCUguuuccguga
(d) ACGCAUGCGaugGUCUUGCCGUUGACCUGA
(e) ACGCAUGCGaugccuagGUCUguuuccgugaUGCCGUUGACC UGA
(^13) How is gene expression similar to DNA replication, and how is it
different? Give at least one similarity and one difference.
Leveling Up
(^14) Write Now biology: genotype to phenotype Your roommate,
who is also taking a biology class, has become a little confused.
He informs you that the genetic code is known to be ambiguous
because a given genotype may give rise to a variety of phenotypes
during gene expression (for example, his twin brother is an inch
taller and more tan than he is). You like your roommate and would
like him to pass his next biology exam, so you decide to help him.
Write him a brief note explaining (a) why the genetic code is not, in
fact, ambiguous and (b) how gene expression derives a phenotype
from a genotype.
(^15) What do you think? Most people carry two copies of a
normal gene that codes for an enzyme, glucosylceramidase, that
is involved in breaking down lipids no longer needed in cells.
(Enzymes are proteins that cause specific chemical changes;
they are biological catalysts.) One in 100 people in the United
(^5) Place the following steps of translation in the correct order by
numbering them from 1 to 9.
a. A tRNA molecule carrying the amino acid methionine binds
at its anticodon site to the mRNA start codon.
b. The ribosome links the first amino acid to the second amino
acid to begin the amino acid chain.
c. The ribosome continues to link each amino acid to the
growing amino acid chain.
d. The ribosome reaches a stop codon.
e. An mRNA binds to a ribosome.
f. The mRNA and the completed amino acid chain separate
from the ribosome.
g. The first tRNA, separated from its amino acid, releases
from the mRNA.
h. A tRNA molecule carrying the second amino acid binds to
the second mRNA codon.
i. Each tRNA releases from the mRNA after it is separated
from its amino acid.
(^6) Which of the following are possible reasons that a cell would
regulate its expression of a gene? (Select all that apply.)
(a) an increased need for a particular enzyme
(b) a decreased need for a particular enzyme
(c) increasing temperature in the external environment
(d) changing needs as an organism ages
(e) death
Challenge Yourself
(^7) Using the genetic code shown in Figure 10.9, find the amino
acid coded by each of the following codons.
(a) AAU
(b) UAA
(c) AUA
(d) GGG
(e) CCC
(^8) Using the genetic code shown in Figure 10.9, find a codon that
codes for each of the following amino acids.
(a) arginine
(b) alanine
(c) methionine
(d) glycine
(^9) During transcription, what RNA molecule will be made from the
DNA template CGTTACG?
(a) CGTTAGC
(b) GCAAUGC
(c) GCATTGC
(d) CGUUAGC