Biology Now, 2e

(Ben Green) #1

208 ■ CHAPTER 11 Evidence for Evolution


● (^) Biogeography uses knowledge about evolution and plate tectonics
to make predictions about the geographic locations where fossils
will be found.
● (^) Similarities in embryonic development of different organisms
show that the characteristics of modern organisms arose through
evolutionary modifications of traits inherited from common
ancestors.


THE QUESTIONS


The Basics


(^1) Intermediate fossils
(a) share some similarities with their ancestral group.
(b) share some similarities with their descendant groups.
(c) both of the above
(d) none of the above
(^2) If two different organisms are closely related evolutionarily,
then they will
(a) be similar in size.
(b) share a recent common ancestor.
(c) have very different DNA sequences in their genes.
(d) be randomly located throughout the world.
(^3) When two organisms are very distantly related in an
evolutionary sense,
(a) they should have extremely similar embryonic development.
(b) they must share a very recent common ancestor.
(c) the sequences of DNA in their genes should be less similar
(more different) than those of two more closely related
organisms.
(d) they should share more homologous traits than two more
closely related organisms share.
(^4) Link each term with the correct definition.
BIOGEOGRAPHY 1. A reconstruction of the history of life on
Earth.
FOSSIL RECORD 2. The similarities in the nucleotide sequences
among related organisms.
DNA SEQUENCE
SIMILARITY



  1. The similarities among organisms that are
    due to the fact that the organisms evolved
    from a common ancestor.
    EMBRYONIC
    SIMILARITY

  2. The geographic locations where related
    organisms and fossils are found.
    HOMOLOGOUS
    TRAITS

  3. Specifically during development, complex
    structures in descendant species that are
    generally elaborations of structures that
    existed in the common ancestor.


Challenge Yourself


(^5) All mammals have tailbones and muscles for moving a tail.
Even humans have a reduced tailbone and remnant tail-twitching
muscles, though these features have no apparent usefulness.
These traits in humans would best be described as
(a) convergent structures.
(b) fossil evidence.
(c) evidence from biogeography.
(d) vestigial traits.
(^6) Reduced tailbones and the associated remnant muscles in
humans are an example of what type of evidence for common
descent?
(a) artificial selection
(b) homologous traits
(c) biogeography
(d) fossil evidence
(^7) When a population evolves to be better fitted to its
environment, this is an example of , which is brought
about by the process of.
(^8) In one sentence each, identify the similarities and the
differences between artificial selection and natural selection.
Tr y Something New
(^9) Cat DNA is much more similar to dog DNA than to tortoise
DNA. Why?
(a) Cats and dogs are both carnivores and take in similar nutrients.
(b) Cats and dogs have lived together with humans for a long
period of time, so they have grown more similar.
(c) Cats and dogs have more offspring during their lifetime than
tortoises have, so their DNA changes less rapidly.
(d) Cats and dogs have a common ancestor that is more recent
than the common ancestor of cats and tortoises.
(^10) DNA sequences were analyzed from humans and three other
mammals: species X, Y, and Z. Which of these mammals is most
closely related to humans? (Note: Regions identical to human DNA
are shown in bold type.)
Human:
AATGCTTTGGGGGATCGCGAGCGCAGCGC
Species X:
GGGTTTTTATCGCTATATATATATA
Species Y:
AATGCTTTGGGGGATCGCGAGCGCATATA
Species Z:
AATGCGGGTTTTTATCTATATATATATATA

Free download pdf