Cell - 8 September 2016

For the first cycle, for each sample, we performed 12 PCR reactions.

Master Mix:

d 325 ml OneTaq 2x master mix (NEB # M0482L)

d 13 ml 10uM FP

d 13 ml 10uM RP

d 156 ml sample DNA (diluted to 75ng/mL or the entire DNA sample if between 40 - 75ng/mL DNA)

d 143 mldH 2 O

d 650 ml total

50 ml of master mix is aliquoted into 12 wells of a 96 well plate and the following PCR reaction is run on a thermocycler:

1. 94C 10 min


2. 94C 3 min


3. 55C 1 min


4. 68C 1 min


5. Repeat steps 2-4 for a total of 3 cycles


6. 68C 1 min


7. Hold at 4C

We then add 250ml of P1 buffer from QIAquick PCR purification kits (QIAGEN # 28106) to each PCR reaction and then perform PCR
cleanups following the standard QIAGEN protocol in two columns (6 PCR reactions pooled into each column). This results in 50ml
eluate of purified PCR product in two tubes for each sample.
For the second step of PCR, we use the following HPLC purified primers (where x is a phosphothioate group)

PE2 - xAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCxT (read1)

PE1 - xCAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCxT (read2)

Master mix:

d 175 ml PrimestarMAX 2x master mix (Clontech # R045B)

d 7 ml10mM PE1

d 7 ml10mM PE2

d 90 ml purified PCR product

d 71 mldH 2 O

d 350 ml total

50 ml of this master mix is added to each of 6 wells in a 96 well PCR plate, and the following reaction is run:

1. 98C 2 min


2. 98C10s


3. 69C15s


4. 72C15s


5. Repeat steps 2-4 for a total of 24 cycles


6. 72C 1 min


7. Hold at 4C

250 ml of Buffer P1 from the Quiagen kit is again added to each of these PCR wells, and all 6 wells are used in a single PCR pu-
rification protocol to generate a single tube with 50ml elutent with purified PCR product from the sample.

Removal of the Reference Strain Amplicons Using Restriction Digestion and Size Selection
We conducted the ApaLI digest of the reference strain reads as follows. We added 60mlH 2 O, 10ml 10XCutSmart buffer
(NEB # B7204S), 5ml ApaLI enzyme (NEB # R0507S) and 25ml of the purified PCR product to a single tube and digested
for 2 hr at 37C. After digestion, we did a standard PCR purification using the QIAGEN QIAquick PCR purification kit
(QIAGEN # 28106) on the 100ml of digestion mixture and eluted in 30ml of buffer EB. After digestion, we conducted size selection
using E-Gels (ThermoFisher # G661002) with 25ml of the purified digestion product and selected the band atz350 bp for
sequencing.

e6 Cell 167 , 1585–1596.e1–e15, September 8, 2016