Correction
Cistrome and Epicistrome Features Shape
the Regulatory DNA Landscape
Ronan C. O’Malley, Shao-shan Carol Huang, Liang Song, Mathew G. Lewsey, Anna Bartlett, Joseph R. Nery, Mary Galli,
Andrea Gallavotti, and Joseph R. Ecker
Correspondence:[email protected]
http://dx.doi.org/10.1016/j.cell.2016.08.063
(Cell 165 , 1280–1292; May 19, 2016)
In the above article, we described an approach, termed ‘‘DNA Affinity Purification Sequencing’’ (DAP-seq) to probe specific tran-
scription factor binding interactions with genomic DNA. The method relies on isolation of fragments of genomic DNA followed by
ligation of specific adaptor oligonucleotides, which are later used to amplify the TF-bound fragments.
In the Supplemental Experimental Procedures, the Adaptor B sequence shown was missing the 5^0 phosphate modification required
for ligation, and the Illumina TruSeq Index primer was shown as the reverse complement of the sequence used in the analyses. The
correct sequences are: Adaptor B: 5^0 P-GATCGGAAGAGCACACGTCTG and TruSeq Index primer: 5^0 -CAAGCAGAAGACGGCATAC
GAGAT-NNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (where the NNNNNN represents the six-base-pair sequence
index used for sample identification).
These changes, which have been made to the article online, will enable amplification of genomic DNA fragments in the system as
described. We apologize for any inconvenience this error may have caused.
1598 Cell 166 , 1598, September 8, 2016