- Select the correct statement regarding repression of
genes.
(a) It refers to switching on of operon that usually remains
turned off.
(b) It initiates transcription and translation of structural
genes.
(c) It involves the blocking of operator gene of operon.
(d) None of these.
- Arrange the various steps of DNA fingerprinting technique
in the correct order.
(i) Separation of DNA fragments by electrophoresis
(ii) Digestion of DNA by restriction endonucleases
(iii) Hybridisation using labelled VNTR probe
(iv) Isolation of DNA
(v) Detection of hybridised DNA fragments by auto-
radiography
(vi) Transferring the separated DNA fragments to
nitrocellulose membrane
(a) (iv) → (ii) → (i) → (vi) → (iii) → (v)
(b) (iv) → (i) → (ii) → (iii) → (vi) → (v)
(c) (ii) → (i) → (iv) → (vi) → (iii) → (v)
(d) (iii) → (v) → (iv) → (ii) → (i) → (vi)
- The bacteria growing in normal environment was selected
for studying its growth rate. The bacteria was moved
from an environment with a light nitrogen isotope (^14 N)
to an environment with heavy nitrogen isotope (^15 N)
and its growth was studied for a period of exactly one
duplication. After this, the sample is again transferred to
the environment with light nitrogen for a period of two
duplications.
What is the composition of hybrid DNA after the experiment?
(a) 75% (b) 50%
(c) 0% (d) 25%
- Which of the following mRNA will get translated
completely?
(a) AUGUUUCCUCAUUAGGGUGUU
(b) GUGUUUCCUCAUGGUUGAGUU
(c) AUGUUUCCUCAUGGUGUUUCC
(d) AUGUUUCCUUGAAUGGUUUAA
Match The Columns
- Match Column I with Column II.
Column I Column II
A. Helicase (i) Stabilises ssDNA
B. Single stranded (ii) Releases tension in uncoiled
binding protein DNA
C. Topoisomerase (iii) Synthesises primers
D. Primase (iv) Unwinds DNA strands
- Match Column I with Column II. (There can be more than
one match for items in Column I).
Column I Column II
A. Initiation codon (i) AUG
B. Phenylalanine (ii) UAA
C. Template strand (iii) UUU
D. Termination codon (iv) Minus strand
E. Non-template strand (v) Plus strand
F. Arginine (vi) GUG
(vii) UGA
(viii) AGG
(ix) Antisense strand
(x) CGU
(xi) UUC
(xii) Sense strand
Passage Based Question
- Complete the given passage with appropriate words or
phrases.
The double helical structure of DNA was proposed by (i)
and (ii) on the basis of data obtained from (iii). According
to their model, the two chains of double stranded helix run
(iv) to each other. The backbone of each chain is made of
(v). The (vi) of two chains form complementary pairs. The
DNA usually shows (vii) coiling producing major and minor
grooves alternately. The pitch of helix in B-DNA is 3.4 nm
with (viii) base pairs in each turn. However, another right
handed, (ix) has only a single turn of helix with (x) base
pairs that lie 20° away from the axis.
Assertion & Reason
In each of the following questions, a statement of Assertion
(A) is given and a corresponding statement of Reason (R)
is given just below it. Of the statements, mark the correct
answer as :
(a) if both A and R are true and R is the correct explanation of A
(b) if both A and R are true but R is not the correct explanation
of A
(c) if A is true but R is false
(d) if both A and R are false.
- Assertion : DNA is preferred over RNA for storage of
genetic information.
Reason : DNA undergoes rapid mutation and evolves very
fast.
- Assertion : One gene one enzyme hypothesis was
changed into one gene one polypeptide hypothesis.
Reason : One gene one enzyme hypothesis states that
structural gene specifies synthesis of many polypeptides.
- Assertion : DNA polymorphism is the basis for genetic
mapping of human genome as well as DNA fingerprinting.
Reason : Polymorphism in DNA arises due to mutations.
- Assertion : The opposite strands of DNA chains are
not identical but complementary to each other.
Reason : Specific base pairing occurs between a purine
lying opposite to a pyrimidine.
