Nucleic Acids in Chemistry and Biology

156 Chapter 4

5’-p*TAATACGACTACATATAGGGAGA

3’-ATTATGCTGAGTGATATCCCTCTYTCAG

dXTP

5’-p*TAATACGACTACATATAGGGAGAX

3’-ATTATGCTGAGTGATATCCCTCTYTCAG

X=analogueorA,T,C,G

Y=analogueorT,A,G,C

DNA polymerase

Figure 4.14 Primer extension reactions with DNA (or RNA) polymerases may be used to study the incorporation of
nucleoside analogues as their 5
-triphosphates (Xanalogue) or their properties when placed in a
DNA template (Yanalogue)

at 35°C. 2
-TOM deprotection uses 1 M TBAF/THF. Removal of the 2
-hemiacetal occurs with the add-
ition of 1 M Tris buffer. Purification is similar to that for TBDMS chemistry.

4.2.2.2.3 ACE Chemistry. Removal of the phosphate methyl ester is effected first by use of 1 M

disodium 2-carbamoyl-2-cyanoethylene-1,1-dithiolate. Cleavage of the oligonucleotide from the solid
support and removal of the nucleobase protecting groups is carried out with 40% aqueous methylamine at
55°C for 10 min, which also cleaves the acetyl groups from the ACE protecting group, rendering it acid-
labile. Alternatively, the oligoribonucleotide can be desalted after release from the support and stored with
the 2
-ACE protecting group intact. The ACE group may then be removed under mild acidic conditions
just before use since the by-products from that deprotection are all volatile. Oligoribonucleotides may be
purified by HPLC or by gel electrophoresis at either 2
-protected or deprotected stages (Section 4.1.4).

4.3 Enzymatic Synthesis of Oligonucleotides

Oligonucleotides of less than 50 residues are not usually prepared enzymatically because their chemical
synthesis is very efficient and capable of producing sufficient quantities for most purposes. However, there
are some occasions when it is desirable to synthesise oligonucleotides enzymatically. In particular enzym-
atic synthesis is used frequently to incorporate the triphosphate of a nucleoside analogue onto the 3
-end
of a chemically-synthesised DNA primer in a primer-extension reaction. Further, RNA transcription is
usually less expensive than chemical synthesis, especially on larger scale, and is more efficient than chem-
ical synthesis for lengths of RNA of 50 residues or more.

4.3.1 Enzymatic Synthesis of Oligodeoxyribonucleotides

Numerous nucleoside and related analogues have been synthesised and their properties studied in enzym-
atic reactions (see Sections 3.1 and 3.7). Most commonly, such analogues are converted into a phospho-
ramidite or H-phosphonate and incorporated into an oligonucleotide (Section 4.4) so that their properties
within a templatemay be studied. Alternatively, the analogue may be converted into a 5
-triphosphate
derivative and then incorporated at the 3
-end of an oligodeoxyribonucleotide primerin a primer-
extension reaction(Figure 4.14). In each case, a short (typically 18–24 nucleotide) primer is annealed to
a template and extension carried out in the presence of deoxyribonucleoside triphosphates and a DNA
polymerase (see Section 3.6.1) (e.g.exonuclease-deficient Klenow fragment, or Ta qDNA polymerase, see
Section 5.2.2). To visualise the reaction it is necessary first to label the primer, typically by addition of
5
-^32 P-phosphate with T4 polynucleotide kinase (see Section 5.3.3) or by incorporation of a fluorescent
label onto the 5
-end of the primer during chemical synthesis.

http://www.ebook3000.com