Nucleic Acids in Chemistry and Biology

158 Chapter 4

carries no terminal phosphate whereas the donor is phosphorylated at both ends. The 3
-phosphate of the
donor acts essentially as a protecting group. After joining it can be removed by treatment with alkaline
phosphatase to generate a free 3
-hydroxyl group and thus a new potential acceptor. A particularly useful
application is in the^32 P-labelling of RNA, where T4 RNA ligase is used to catalyse the addition of
[^32 P]pCp to the 3
-end of the RNA.
Another method for joining RNA involves the use of a DNA ligase from bacteriophage T4 (normally
used to join DNA, see Section 5.3.5) to unite two oligoribonucleotides or segments of RNA in the pres-
ence of a complementary oligodeoxyribonucleotide splint.^14 Both donor and acceptor oligoribonu-
cleotides can be obtained by T7 RNA polymerase transcription or by chemical synthesis. In the example
shown (Figure 4.17), the donor may be prepared by transcription with an rGpG or rG primer (this section)
and then 5
-phosphorylated by the use of ATP and T4 polynucleotide kinase. Advantages of this method
of ligation include a high sensitivity for acceptor oligoribonucleotides of the correct sequence (i.e.incor-
rect n1 long acceptor transcripts are not joined) and the lack of a need for 3
-protection of the donor
oligoribonucleotide. The method has proved useful in incorporation of rG analogues at the joined site.

4.4 Synthesis of Modified Oligonucleotides

4.4.1 Modified Nucleobases

Among the many research enterprises that involve modified oligonucleotides, the synthesis of nucleobase-
modified oligonucleotides is probably the largest group.15–19Phosphoramidites of deoxyribo- or ribonucleo-
sides, containing a number of modified nucleobases, are commercially available for incorporation into
synthetic DNA or RNA by standard solid-phase synthesis (Section 4.1) (Figure 4.18). Among numerous
applications, certain modified bases are used to increase the stability of a DNA duplex. For example, 5-
propynyl-dUextends the -structure of the nucleobase and allows improved stacking with neighbouring bases
within a DNA duplex. 7-Deaza-dG(Figure 4.18b) is an analogue in which the N7 nitrogen atom is replaced
by a methine (CH) group. Thus, it is very useful for understanding the role of the Hoogsteen edge of a G residue
in the recognition of DNA by drugs and enzymes within the major groove of a synthetic DNA duplex (see
Chapters 9 and 10). It is also used as a triphosphate analogue in place of dGTP for improving DNA sequen-
cing (see Section 5.1) where a long run of dG residues would be formed in a sequencing reaction that would
result in unusual structures, such as G-quartets (see Section 2.3.7). 5-BromodUand 5-iododU derivatives
undergo photolytic cross-linking reactions and are useful for DNA–protein cross-linking. Similarly 4-thioUis
useful for RNA–RNA and RNA–protein photocross-linking.2-Aminopurineis an example of a fluorescent
base with a high quantum yield that is useful for probing the conformation of RNA structures (Figure 4.18e).^20

p

AGGUAGCUUGGACCAOH

TCCATCGAACCTGGT

PGGUGAGAUAUGGCCA

CCACTCTAUACCGGT

AGGUAGCUUGGACCAGGUGAGAUAUGGCCA

T4 DNA ligase

3' 5'

oligodeoxyribonucleotide

splint

Figure 4.17 Joining of oligoribonucleotides by use of T4 DNA ligase

N 1 pN 2 pN 3 + pN 4 pN 1 pN 2 pN 3 pN 4 p

ATP AMP + PPi

Figure 4.16 Joining oligoribonucleotides by use of RNA ligase

http://www.ebook3000.com