6.8.1.2 Some Implications of Recombination. We have already seen that recombination offers
advantages to the organism by assorting alleles and repairing genes. What other advantages does it give?
One major effect is the potential for expanding or contracting the number of copies of genes by unequal
exchange(Figure 6.8), leading to the evolution of multi-gene families. Another consequence of recom-
bination is gene conversion.^57 The normal product of homologous recombination is the swapping of DNA
between two duplexes (Figure 6.39). Sometimes however, two copies of one duplex are produced whereas
the other is destroyed. Gene conversion provides an evolutionary mechanism for genes to edit and correct
one another, while remaining unchanged themselves.
6.8.2 Site-Specific Recombination
Recombination is sometimes used to control gene expression.^61 One well studied example is the integration of
bacteriophage DNA into the chromosome of its host, E. coli. When bacteriophage virus infects E. coli, two
outcomes are possible. Either, lytic growth of the virus results in the destruction of the host cell and release of
many virus particles or the bacteriophage remains dormant in the cell. In the latter case, called lysogeny,
the viral DNA becomes integrated into the E. colichromosome and thus becomes a part of its host genome
(Figure 6.40). The process is a site-specific recombinationevent, which is catalysed by a -encoded enzyme,
called an integrase, which recognises the recombination sites (which are called attsites) on and E. coli:
5 CTGGTTCAGCTTTTTTATACTAAGTTGGCAT 3
5 TGAAGCCTGCTTTTTTATACTAACTTGAGCG 3E. coliThis process can be made to occur in vitroby use of only the two DNAs, Mg^2 , integrase and an
E. coliprotein called integration host factor (IHF). In this way it has been shown that the integration event,
which involves a Holliday junction intermediate, resembles the type I topoisomerase-catalysed reactions
(Section 2.3.5). Lastly, this process can be reversed with the aid of another protein called an excisionase,
encoded by the xisgene, in addition to integrase.
6.8.3 Transposition and Transposable Elements
There is another major class of DNA rearrangement, which is not dependent on sequence homology. This
is the process of transposition, which involves the movement of DNA into new locations in the host
genome.62,63DNAs which move in this way are collectively termed transposable elementsor transposons,
although the latter term more properly applies only to a subset of prokaryotic transposable elements.
In transposition (Figure 6.41), a discrete transposable element becomes inserted into a target site, which
bears no significant homology with the transposable element sequence. A short stretch of DNA sequence,
242 Chapter 6
Figure 6.39 Gene conversion
Figure 6.40 Bacteriophage linserts into the E. coli chromosome by homologous recombination at att sites