- oligo-dT:
50 AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTT-
TTTTTTTTTTTTTTTTTTTVN3^0 (HPLC purified, store at
10 μM concentration in ddH 2 Oat 20 C for several months),
can be freeze-thawed several times. - TSO-LNA oligo: 5^0 AAGCAGTGGTATCAACGCAGAGTACr
GrG + G3^0
(HPLC purified, store at 100μM concentration in ddH 2 Oat
80 C, several freeze–thaw cycles are ok). - ISPCR primer: 5^0 AAGCAGTGGTATCAACGCAGAGT3^0
(HPLC purified, store at 10μM concentration in H 2 Oat
20 C for several months), can be freeze-thawed several
times. - High fidelity hot start PCR mix (e.g., Kapa HiFi HotStart
Ready Mix). - Master mix 1 (Reverse transcription 1): 1μL dNTPs mix, 1μL
Oligo dT, 0.1μL ERCC spike-ins, 2.1μL per sample. - Master mix 2 (Reverse transcription 2): 2μL5SSRT II
buffer, 0.5μL 100 mM DTT, 2μL 5 M Betaine, 0.1μL1M
MgCl 2 , 0.25μL RNase inhibitor, 0.5μL SSRT II enzyme, and
0.1μL TSO-LNA oligo; 5.45μL sample. - Master mix 3 (PCR): 12.5μL2KAPA HiFi HotStart Ready
mix, 0.2μL ISPCR primer, and 2.3μL ddH 2 O; 15μL per
sample.
2.5.2 Bead Purification 1. 80% ethanol, prepared fresh every week.
- 96-well plates (V-bottom).
- Magnetic stand for 96-well plates.
- Vortex.
- Magnetic beads, hydrophilic.
- 19.5% and 24% PEG bead solution: magnetic beads in 19.5 or
24% PEG 8000, 1 M NaCl, 10 mM Tris–HCl pH¼8.0, 1 mM
EDTA, 0.01% Igepal CA630, and 0.05% sodium azide. - Elution buffer (EB): 10 mM Tris–HCl, pH 8.5 (e.g., Qiagen).
2.5.3 Tagmentation and
Sequencing Index Ligation
- Nextera XT Index Kit (Illumina).
- 5 TAPS-Mg buffer: 50 mM TAPS-NaOH pH 8.5 and
25 mM MgCl 2. - 0.2% SDS in ddH 2 O.
- High fidelity PCR enzyme (e.g., Kapa Hifi DNA polymerase kit
with dNTPs). - Master mix 4 (Tagmentation): 5μL 40% PEG 8000, 4μL5
TAPS-Mg, and 0.4μL ~12.5μM Tn5 enzyme (seeNote 20)
[3]; 9.4μL per sample.
Spatial Transcriptomic Profiling Using LCM-seq 99