disruption of the PeT and FRET quenching upon binding of the
aptamer to the quencher, the fluorescence turn-on ratios obtained
in both scenarios were too low (~4–8-fold enhancement) for prac-
tical imaging purposes.
An RNA aptamer showing high affinity and specificity toward
dinitroaniline was generated by SELEX and named dinitroaniline-
binding (DNB) aptamer (seeFig. 2b)[22]. We also synthesized a
range of fluorogenic dyes spanning across the visible spectrum by
conjugating known dyes (FL: fluorescein, RG: rhodamine green,
TMR: tetramethylrhodamine, SR: sulforhodamine, TR: TexasRed)
to the dinitroaniline (DN) contact quencher (see Fig. 3) and
showed that the fluorescence of all the fluorophores was quenched
efficiently. Next, the DNB aptamer was found to bind all of the
fluorogenic dyes, leading to fluorescence increase ranging from 5-
to 73-fold in vitro and in living cells (seeNote 2). When expressed
inE. coli, the DNB aptamer could be labeled and visualized with
different colored fluorophores and can be used as a genetically
encoded tag to image target RNAs. Furthermore, combining
contact-quenched fluorogenic dyes with orthogonal DNB and
SRB-2 aptamers allowed dual-color imaging of two different
fluorescence-enhancing RNA tags in living cells, opening new ave-
nues for studying RNA co-localization and trafficking.
In this chapter, we describe a detailed protocol of our aptamer
based RNA imaging method for labeling stable and highly abun-
dant RNAs in live bacterial cells. Moreover, using tandem repeats of
the DNB aptamer, we explain how to label GFP mRNA in liveE.
coli.2 Materials
2.1 Plasmid
Construction
- pET28 plasmid (Agilent Technologies).
- pET-tRNA (seeNote 3).
- pET-SRB2 and pET-DNB containing SRB-2 and DNB apta-
mers, respectively (seeFig. 4b,Note 3). - pET-SRB2-DNB (seeFig. 4c,Note 4).
- pET-GFP-4xDNB and pET-GFP-8xDNB (seeFig. 4d,Note 5).
- Oligonucleotide primers one of which should contain SRB-
2 or DNB sequence (see Note 6) (SRB-2: 5^0
GGAACCTCGCTTCGGCGATGATGGAGAGGCGCAAGG
TTAACC GCCTCAGGTTCC; DNB: 5^0 GGTGCCTTATT
CCGGACGCCGGGCCCGAATGCTGCT ACGGCAGTCG
AAGACAACATCGCGCCCTTCGGAGGCACC). - dNTP (10 mM of each nucleotide) solution.
- Thermostable DNA polymerase.
292 Murat Sunbul et al.