Biology 12

258 MHR • Unit 3 Molecular Genetics

a particular nucleotide sequence on the DNA

molecule. These nucleotide sequences provide a

binding site for RNA polymerase, the main enzyme

that catalyzes the synthesis of mRNA.

The promoter sequence on a DNA strand is

usually rich in T and A nucleotides, and is therefore

often referred to as a TATA box. Figure 8.7 shows

the location of the two promoter sequences found

in Escherichia coli. For transcription to be initiated,

both of these promoter sequences must be present

in their correct locations. For any given gene, the

complete promoter signal (here comprised of the

two promoter sequences) is found on only one

strand of the DNA molecule. However, either strand

can house the sense strand for different genes. At

the same time, the nucleotide sequences in the

promoters are slightly different from one another,

which means that RNA polymerase will bind in

only one orientation. The enzyme can thus face

only one way along the DNA molecule, meaning

that transcription will proceed in only one direction.

Once the polymerase molecule has bound to the

DNA molecule, it opens a section of the double

helix and begins synthesizing a strand of mRNA

that is complementary to the template DNA strand.

Promoter sequences ensure that transcription

begins at the right place along a DNA molecule.

These nucleotide sequences also keep the cell from

expending energy on transcribing DNA that does

not have a coding function. As you saw in the

previous chapter, much of the genome of a eukaryote

may be made up of stretches of DNA that do

not code for protein products. The existence of

promoter sequences means that RNA polymerase

will only bind to and transcribe those small

portions of the genome that contain genes.

Elongation of mRNA Transcript

The elongation of an mRNA transcript works in

much the same way as the elongation of a new

DNA strand during the process of DNA replication

(which was discussed in Chapter 7). Like DNA

polymerase, RNA polymerase works in the 5 ′to 3 ′

direction, adding each new nucleotide to the 3 ′-OH

group of the previous nucleotide. RNA transcribes

only one strand of the DNA template, however.

Thus, there is no need for Okazaki fragments. The

process of elongation is illustrated in Figure 8.8 on

the next page.

RNA polymerase moves along the double helix,

opening it one section at a time. As the polymerase

molecule passes, the DNA helix re-forms and the

mRNA strand separates from its template DNA

strand. As soon as this RNA polymerase begins

tracking along the DNA molecule after leaving the

promoter region, a new RNA polymerase can bind

there to begin a new transcript. This means that

dozens or even hundreds of copies of the same

gene can be made in a very short time. Figure 8.9

on the next page shows elongating mRNA strands

trailing out from their DNA template.

Unlike DNA polymerase, RNA polymerase has

no proofreading function. As a result, transcription

is considerably less accurate than DNA replication.

Any errors in transcription are contained only in a

single protein molecule, however. Therefore, they

do not become part of the permanent genetic

material of the organism. Consequently, the lower

On any given molecule of DNA, either strand can serve as

the sense strand for different genes. In some viruses, the

same stretch of DNA can contain two different genes —

one transcribed in each direction along the same section

of base pairs.

BIO FACT

3 ′ 5 ′

5 ′ 3 ′

ATCACATAACTGTACTATCTTCGTGAGATGATATAAGAGTTATCCAGGTGC

5 ′ TAGTGTATTGACATGATAGAAGCACTCTACTATATTCTCAATAGGTCCACG 3 ′

untranscribed strand of DNA DNA

promoter sequences

RNA polymerase site

template strand of DNA transcription start site direction of

transcription

section of mRNA produced AGGUCCACG

Figure 8.7If the two different promoter sequences found

in E. coliDNA are present at the correct locations, RNA

polymerase can bind to the DNA molecule. By convention,

the promoters are written according to their nucleotide

sequence along the non-transcribed DNA strand. The

combination of two different promoter sequences means

that RNA polymerase will bind in only one way to the DNA

molecule and, therefore, that transcription will only take

place in one direction.