Biology Times (^) March 19
(a) 5′-TAGTACG-3′ (b) 5′-ATCATGC-3′ y
(c) 5′-UTCUTGC-3′ (d) 5′-GCUAGCA-3′
- A new life form discovered on a distant planet
has a genetic code consisting of five unique
nucleotides and only one stop codon. If each
codon has four bases, what is the maximum
number of unique amino acids this
life form can use? [2014]
(a) 624 (b) 20 (c) 124 (d) 3124 - In Griffith’s experiments mice died when
injected with [2014]
(a) heat killed S-strain
(b) heat killed S-strain combined with R-strain
(c) heat killed R-strain
(d) live R-strain - The sequences of four DNA molecules are given
below: [2013]
(i). TATATATATATATA
ATATATATATAT
(ii).TTTCCCGGGAAA
AAAGGGCCCTTT
(iii).TTGCGTTGCCC
AACGCAACGGG
(IV). GCCGGTCCGGC
CGGCCTAGGCCG
Which one of these D N A molecules will have
the highest melting temperature?
(a) i (b ) ii (c) iii (d) iv - If DNA Codons are A TG GAA, insertion of
thymine after the first condon results in , [2013]
(a) non-sense mutation
(b) mis-sense mutation
(c) frameshift mutation
(d) silent mutation - Watson and Crick model of DNA is [2013]
(a) B-form DNA with a spiral length of 34 Å
and a diameter of 20 Å
(b) A-form DNA with a spiral length of 15 Å
and a diameter of 20 Å
(c) Z-form DNA with a spiral length of 34 Å and
a diameter of 20 Å
(d) B-form DNA with aspiral length of 28 Å and
a diamenter of 14 Å - Transfer RNA (tRNA) [2012]
(a) is present in the ribosomes and provides
structural integrity
(b) usually has clover leaf-like structure
(c) carries genetic information form DNA to
ribosomes
(d) codes for proteins- If the sequence of bases in sense strand of DNA is
5’-GTTCATCG-3’, then the sequence of bases in
its RNA transcript would be [2012]
(a) 5’-GTTCATCG-3’ (b) 5’-GUUCAUCG-3’
(c) 5’-CAAGTAGC-3’ (d) 5’-CAAGUAGC-3’ - The following sequence contains the open reading
frame of a polypeptide. How many amino acids
will thepolypeptide consists of?
5’ AGCATATGATCGTTTCTCTGCTTTGAACT
-3’
[2012]
(a) 4 (b) 2 (c) 10 (d) 7 - A protein with 100 amino acid residues has been
translated based on triplet genetic code. Had the
genetic
code been quadruplet, the gene that codes for the
protein would have been [2011]
(a) same in size
(b) longer in size by 25 %
(c) longer in size by 100 %
(d) shorter in size - If the sequence of base in DNA is 5’-ATGTATC
TCAAT-3’, then the sequence of bases in its
transcript will be [2011]
(a) 5’-TACATAGAGTTA-3’
(b) 5’-UACAUAGAGUUA-3’
(c)5’-AUGUAUCUCAAU-3’
(d) 5’-AUUGAGAUACAU-3’ - Puffs in the polytene chromosomes of Drosophila
melanogaster salivary glands represent [2011]
(a) transcriptionally active genes
(b) transcriptionally inactive genes
(c) heterochromatin
(d) housekeeping genes - According to the original model of DNA, as
proposed by Watson & Crick in 1953, DNA is a
[2011]
(a) left handed helix
(b) helix that makes a full turn every 70 nm
(c) helix where one turn of DNA contains 20
basepairs
(d) two stranded helix where each strand has
opposite polarity - E.coli about to replicate was pulsed with tritiated
thymidine for 5 min and then transferred to
normal After one cell division which one of the
following observations would be correct?
[2011]
(a) both the strands of DNA will be radioactive