The diagram below shows two pieces of DNA
that have been cut with the same restriction
enzyme. Use the diagram and your knowledge
of science to answer questions 1–3.
1.What nucleotide sequence must the sticky
end labeled Bhave if it is to bond with the
sticky end labeled A?
A UGGCCU C ACCGGT
B TCCGGA D CTTAAG2.What enzyme would have to be used to
produce recombinant DNA from these
two pieces?
F DNA polymerase H DNA ligase
GRNA polymerase J DNA helicase
3.If the restriction enzyme leaves comple-
mentary sequences on the ends of each
piece of DNA it cuts, what will the recombi-
nant DNA that results from these two
pieces consist of?
A One linear, double-stranded molecule
B One circular, double-stranded molecule
CTwo linear, single-stranded molecules
DTwo circular, single-stranded moleculesTest
CHAPTER 11Review 245
Critical Thinking
- Applying InformationHow is natural selec-
tion affected by genetic engineering? - Forming Reasoned OpinionsIn the United
States, government regulations require
researchers to contain experimental
genetically engineered organisms inside
a laboratory and to ensure that the
organisms could not survive outside the
laboratory. Why do you think these strict
regulations are necessary? - Distinguishing Fact from OpinionA judge
presiding over a highly publicized murder
trial dismissed the prosecution’s request to
admit DNA fingerprints as evidence, call-
ing it “unproven.” Do you agree with the
judge? Explain your answer. - Distinguishing Relevant InformationOrga-
nize and videotape a class debate about the
safety questions raised by the potential
release of genetically engineered plants,
bacteria, and animals into the environ-
ment. Use library references and on-line
databases to back up your arguments.
Alternative Assessment
- Finding InformationThe question of
awarding patents on genetically engineered
organisms arose when a microbiologist
named Ananda Chakrabarty filed for a
patent on a bacterium capable of digesting
the components of crude oil. Use the media
center or Internet resources to learn more.
Find out about the bacterium that was engi-
neered and the court battle for the right to
obtain a patent for it. Prepare an oral report
using graphics to summarize your findings.
Present the report to your class. - Analyzing DataPlant normal tomato
seeds and seeds from a genetically engi-
neered variety of tomato in separate labeled
containers. Grow the plants side by side.
Compare the number and quality of toma-
toes produced by each plant. Create a poster
that summarizes your findings. Present the
report to your class. - Career ConnectionGenetic Engineer
Research the field of genetic engineering.
Write a report that includes a job descrip-
tion, training required, kinds of employers,
growth prospects, and a starting salary.
TAKS Test PrepTAKS Test Prep
+BPE01P C11REV001 ATGGCCATGGCCAACCGGTACCGGTCompletely darken the area on the answer sheet
that corresponds to each of your answer choices.3C3C3C3C 11C3C 3F6D6A6A6A