Microsoft Word - blank.doc

NEL Molecular Genetics 671

Section20.2

reads a codon (Figure 7). Ribosomes synthesize different proteins by associating with dif-

ferent mRNAs and reading their coding sequences.

A ribosome must begin reading the coding sequence at the correct place in the mRNA,

or it will misread all the codons. The first codon that it recognizes is the start codon

AUG. Binding to the start codon ensures that the ribosome translates the genetic code

using the reading frame of the mRNA molecule. It is critical that the mRNA be positioned

in the ribosome in its reading frame so that the genetic code is translated into the cor-

rect sequence of amino acids.

Once the ribosome has bound the mRNA, how does it get the amino acids that cor-

respond to the codon? This job falls to a second type of RNA molecule known as transfer

RNA(tRNA). At one end of the tRNA there is a sequence of three bases, the anticodon,

that is complementary to the codon of the mRNA. The opposite end carries the corre-

sponding amino acid (Figure 8, next page). For example, if the mRNA has the codon UAU,

the complementary base sequence of the anticodon is AUA, and the tRNA would carry

the amino acid tyrosine. Check Table 1to find the mRNA codon and prove to yourself

that it calls for tyrosine. Every tRNA carries only one specific amino acid, which means

that at least 20 different tRNAs are required. Recall that there are 64 possible codons.

In reality, anywhere from 20 to 64 types of tRNA molecules are available, depending on

the organism.

Figure 6
Ribosomes consist of a large subunit and a
small subunit.

large

subunit

small

subunit

intact ribosome

small subunit

large subunit

polypeptide

chain

ribosome

3’

5’

mRNA

direction of

translation

Figure 7

The large and small subunit of a ribosome

work together to translate a strand of

mRNA into a polypeptide. The polypeptide

grows as the ribosome moves farther along

the mRNA strand.

transfer RNA(tRNA) the form of

RNA that delivers amino acids to a

ribosome during translation

anticodongroup of three

complementary bases on tRNA that

recognizes and pairs with a codon

on the mRNA

Practice

3.Transcribe the following sequence of DNA into mRNA.

TACGGATTTCTCCGCAAATTAGGG

4.Translate the following mRNA sequence into an amino acid sequence.

5 
-AUGCCCUCUAUUCCGGGAAGAUAG-3


5.How many nucleotides are necessary in the DNA to code for the following sequence

of amino acids?

Leu-Tyr-Arg-Trp-Ser

Table 2 Amino Acids and Their

Abbreviations

Amino Three-letter

acid abbreviation

alanine Ala

arginine Arg

asparagine Asn

aspartic acid Asp

cysteine Cys

glutamic acid Glu

glutamine Gln

glycine Gly

histidine His

isoleucine Ile

leucine Leu

lysine Lys

methionine Met

phenylalanine Phe

proline Pro

serine Ser

threonine Thr

tryptophan Trp

tyrosine Tyr

valine Val