Fundamentals of Medicinal Chemistry

(Brent) #1

(continued)


(4) List fivegeneral classesof compound that are collectively known as lipids.
Describe the essential differences between (a) plasmalogens and sphingomye-
lins and (b) cerebrosides, sulphatides and gangliosides.

(5) Draw, number and letter the saturated ring system found in many steroids.
Describe the most common conformations of the rings found in saturated
steroid ring systems.

(6) Distinguish carefully between the members of the following pairs of terms: (a)
nucleotide and nucleoside; (b) introns and extrons; (c) codons and anticodons.

(7) The sequence AATCCGTAGC appears on a DNA strand. What would be the
the sequence on (a) the complementary chain of this DNA and (b) a tran-
scribed RNA chain?

(8) (a) How does RNA differ from DNA? (b) Outline the functions of the three
principal types of RNA.

(9) What is the sequence of amino acid residues in the peptide formed from the
mRNA

UUCGUUACUUAGUAGCCCAGUGGUGGGU
ACUAAUGGCUCGAG?

Indicate which end of the peptide is the N-terminus.


QUESTIONS 35

Free download pdf