RNA Detection

(nextflipdebug2) #1

2 Materials


2.1 Plasmids 1. pmax pona 12xTRICK 24xMS2SL (Addgene #64542, [25]).



  1. Potef-mCherry-cdc3-16boxB-3^0 UTR (Addgene #86465,
    [13]).

  2. phage ubc nls ha pcp gfp (Addgene #64539, [25]).

  3. Potef-λN*-3xGfp-NLS (Addgene #86780, [18]).

  4. pST4 TET CMV intron renilla 24xPP7 24xMS2 (Addgene
    #84444, [25]).

  5. phage UBC NLS-HA-2xMCP-tagRFP (Addgene #64541, [25]).


2.2 PCR Oligos
and Cloning


Underlined sequence represents target specific portion of the PCR
oligos, sequence highlighted in bold shows the newly introduced
restriction site.


  1. PP7loops-SacII-Fwd:
    50 CCGCCGCGGACACGGCCGTGTATTA.

  2. PP7loops-SacII-Rev:
    50 CCGCGGGCTGATCCACTCGAGAGATC.

  3. PP7CP-BamHI-Fwd:
    50 GGCGGATCCATGTCCAAAACCATCGTTCTTTCGG.

  4. PP7CP-BamHI-Rev:
    50 CATGGATCCTGAACGGCCCAGCGGCACAAGG
    TTGACG.
    5.BamHI and SacII restriction enzymes (e.g., New England
    Biolabs).


2.3 Working
Solutions for U. maydis
[31, 32]



  1. Trace elements: 0.06 w/v % H 3 BO 3 , 0.14 w/v % MnCl 2 ·4
    H 2 O, 0.4 w/v % ZnCl 2 , 0.4 w/v % Na 2 MoO 4 ·2 H 2 O,
    0.1 w/v % FeCl 3 ·6 H 2 O, 0.04 w/v % CuSO 4 ·5 H 2 O, add
    ddH 2 O, sterile filter.

  2. Salt solution: 16 w/v % KH 2 PO 4 ,4w/v%Na 2 SO 4 , 8 w/v %
    KCl, 1.32 w/v % CaCl 2 , 8 v/v % trace elements, 1 w/v %
    MgSO 4 (water free), add ddH 2 O, sterile filter.

  3. Vitaminsolution:0.1w/v%thiaminehydrochloride,0.05w/v%
    riboflavin, 0.05 w/v % pyridoxine, 0.2 w/v % calcium panto-
    thenate, 0.05 w/v % p-aminobenzoic acid, 0.2 w/v % nicotinic
    acid, 0.2 w/v % choline chloride, 1 w/v %myo-inositol, add
    ddH 2 O, sterile filter.

  4. Complete medium (CM): 0.25 w/v % casamino acids, 0.1 w/v %
    yeast-extract, 1.0 v/v % vitamin solution, 6.25 v/v % salt solu-
    tion, 0.05 w/v % herring sperm DNA, 0.15 w/v % NH 4 NO 3 ,
    add deionized water, adjust pH with 5 M NaOH to 7.0, add
    glucose (CM-glc) or arabinose (CM-ara) solution after auto-
    claving (1% f.c.).


322 Sabrina Zander et al.

Free download pdf