- Second strand synthesis oligo 5^0 - GTTCAGAGTTCTACA
GTCCGACGATCNNNNNN-3^0.
The underlined portion corresponds to Illumina 5^0 adapter
sequence vital for PCR amplification. - 10Klenow Buffer: 500 mM Tris–HCl pH 7.5, 100 mM
MgCl 2 , 10 mM DTT, and 0.5 mg/mL BSA. Store buffer at
20 C. - S3 master mix (per sample):12μL nuclease-free water, 10μL
10 Klenow Buffer 5μL 10 mM dNTPs, and 10μL10μM
second strand synthesis oligo.
2.7 PCR
Amplification and
Size-Selection of
Libraries
- GoTaq Green 2PCR Master Mix (Promega).
- 10μM5^0 PCR primer
50 - AATGATACGGCGACCACCGAGATCTACACGTTCA
GAGTTCTACAGTCCGA-3^0 - 10μM3^0 Barcoded PCR Primer
5-CAAGCAGAAGACGGCATACGAGATNNNNNNGTG
ACTGGAGTTCCTTGGCACCCGAGAATTCCA- 30. The
NNNNNNrepresents the unique barcode. Use a unique bar-
code for each sample. - 80% ethanol (seeNote 3).
3 Methods
This protocol requires that the relevant RBP–PUP fusion proteins
already be engineered and introduced into cells. Upon request, we
provide a kit that includes plasmids that encode the PUP-2 open-
reading frame, free of charge to any academic lab.3.1 Isolate Total RNA
fromS. cerevisiae
Isolate total RNA from yeast in completely denaturing conditions
(seeNote 4).Timing:steps 3– 21 : 1.5–2 h;steps 22– 31 : 3–4 h.- Place 25 mL ofA 660 ~ 0.5–0.8 cultures on ice for 5 min.
- Harvest cultures by centrifugation at 1900 rcf for 5 min at
4 C. - Wash yeast pellets once with 40 mL of ice-cold water.
- Resuspend yeast in 500μL RNA ISO buffer.
- Add ~200μL of acid-washed beads.
- Add 500μL of phenol–chloroform–isoamyl alcohol.
- Vortex for 20 s at room temp., then incubate for 20 s on ice.
Repeat for a total of ten cycles. - Split into two tubes. Each sample is now in two tubes.
RNA Tagging Library Preparation 459