Biology 12

THINKING LAB

Identifying Mutations and

Predicting Their Consequences

Background

As you have seen, a change in a single nucleotide makes
the difference between a normal hemoglobin protein and
the altered protein associated with sickle cell disease. This
table shows nucleotide sequences from different forms
of an imaginary gene. In this lab, you will examine these
sequences to identify different types of mutations and
predict their consequences.

You Try It

1.Translate the DNA sequence into the mRNA codon

sequence, and then into the amino acid sequence

of the polypeptide product.

2.For each of the mutant varieties of the gene, describe

the type of mutation involved.

3.For each of the mutant varieties of the gene, predict

the likely outcome of the mutation on the organism’s

metabolism. What variables would affect your prediction?

4.Write a nucleotide sequence for the template DNA

strand of the wild gene that includes a point mutation.

Trade mutual sequences with a partner to see how they

compare. What would the cumulative effect of the two

mutations be if they both took place in the same gene?

Within your class, how many pairs of mutations

cancelled each other out? What does this tell you

about the likelihood of reverse mutations occurring

in living organisms?

Gene type Nucleotide sequence (from template DNA strand)

wild (normal)

Mutant 1

Mutant 2

Mutant 3

TACCTCTTTCGGGTAACAATAACT

TACCTCTTTCGGGTAACTAATAACT

TACCTCTTTCGGGTGACAATAACT

TACCTCTTTCGGGTAAAAATAACT

Chapter 9 DNA Mutations and Genetic Engineering • MHR 291

Mutation Repair Mechanisms

Even without exposure to mutagens, each of your
genes undergoes thousands of mutations during
your life. If these mutations all remained intact, the
cumulative effect on your body would be disastrous.
Fortunately, the cells of your body produce hundreds
of types of enzymes that constantly work to repair
damage to your DNA. Several repair pathways
allow a cell to recognize and act on different types
of mutations.

Direct Repair

In some cases, a cell is able to reverse damage to
its DNA. Consider, for example, the proofreading
function of DNA polymerase during DNA
replication. As you saw in Chapter 7, DNA
polymerase is able to recognize an incorrectly paired
nucleotide and correct this error immediately. This
kind of repair is called direct repairbecause it
undoes the damage to the DNA molecule (as
opposed to a repair process that excises and
replaces the damaged section). Another example
of direct repair is found only in prokaryotic cells.
Bacteria such as E. coli, for example, produce an
enzyme that can break pyrimidine dimers quickly.

Excision Repair

An excision repairoccurs when a damaged section
of DNA is recognized and replaced by a newly
synthesized correct copy, as shown in Figure 9.8.

Figure 9.8Eukaryotic cells contain over 50 different types

of excision repair enzymes, each recognizing a particular

type of DNA damage. DNA is the only macromolecule within

living cells that can be repaired.

5 ′

3 ′

3 ′

5 ′

section containing dimer

new section sealed in

place by DNA ligase

excised section removed

Repair enzymes recognize the damaged section of DNA

and cleave the nucleotide strand on either side of the

damage.

A

The damaged section is removed from the DNA molecule.

DNA polymerase builds a new DNA strand by adding

nucleotides in the 5 ′to 3 ′direction.

B

DNA ligase seals the new stretch of nucleotides into the

DNA molecule.

C