95subunit fused to the N-terminal of the large subunit, ending at
D^146 , makes constitutively active caspase-14.- Insert revC14 cDNA into the pET15b vector at the Xho I/
Bam HI sites. - Restriction sites for revC14 consist of Xho I-small subunit-Sal
I-large subunit-Bam HI. Primers used: forward small subunit
with Xho I ccgctcgagaaagacagcccacaaaccatc, reverse primer
with Sal I gaccctccggaaacggctgtatctgcaggtcgaccgca, forward
large subunit primer with Sal I acgcgtcgacatgagcaatccgcg-
gtctttgg, and reverse primer with Bam HI cgggattctaatctccacctact-
gtttcaccggggt. - Express recombinant protein in the E. coli BL21 (DE3) using
Overnight Express Autoinduction System 1 and purify with
Ni-NTA resin. - Check proteolytic activity using WEHD-AFC as a substrate.
revC14 has activity comparable with that of purifi ed caspase-14
from corneocyte extract ( see Note 4 ). - Procaspase-14 cDNA is cloned into pQE 30 vector, expressed
in E. coli, and recombinant protein is purifi ed on Ni-NTA
Agarose column. - Preincubate procaspase-14 (5 μg/μl, 10 μl) with 50–250 ng of
active KLK7 (10 μl) in the KLK7 assay buffer at room tem-
perature for 15 min ( see Note 5 ). - Add 80 μl of the caspase-14 assay buffer and incubate at room
temperature for 10 min. - Add 20 μl of 100 μM Ac-WEHD-AFC and incubate the mix-
ture at 37 °C for 30 min. - Measure activity of caspase-14 on plate reader with 355 nm
excitation and 460 nm emission. - Cleavage-site-directed antibody is prepared by immunizing
rabbits with the synthetic hexapeptide, CTVGGD, in which
TVGGD corresponds to the C-terminal end of the large sub-
unit of the autoprocessed caspase-14. Cysteine residue is added
for the coupling with career protein, such as keyhole limpet
hemocyanin (KLH). h14D146 is purifi ed with affi nity chro-
matography as follows. - Dilute 10 ml of antiserum with PBS (1:1) and mix with 1 ml
of TVGGD-coupled Agarose. Incubate at 4 °C for 3 h with
gentle rotation. - Gel suspension is packed in a small column (PD-10 column is
quite suitable for this purpose), wait until gel is settled, and
discard supernatant.
3.4 Procaspase-14
Activation by KLK7
3.5 Preparation
of Cleavage-Site-
Directed Antibody
3.5.1 Anti-mature
Caspase-14 Antibody
(h14D146)
Caspase-14 Methods