RNA Detection

4. Incubate the plate overnight at 37C.


5. Select a single colony, and culture in a liquid LB medium
   overnight at 37C, and isolate the plasmid using a Plasmid
   Midi Kit.


6. Sequence the insert DNAs using a universal primer (see
   Note 13).

3.7 Live-Cell
Imaging of mRNA
Targets with RT-
Aptamers

1. Seed HeLa cells on 12-well plates (1.0 105 cells per well) and
   culture overnight at 37C.


2. Transfect the cells with the pSuper.neo vector encoding an RT-
   aptamer by using FuGENE HD Transfection Reagent, accord-
   ing to the manufacturer’s protocol [29].


3. Detach the cells from the plates with 0.25 w/v % trypsi-
   n–EDTA and reseed the cells on 96-well plates
   (5.0 103 cells per well) in the complete growth medium.


4. Culture the cells for 4 h at 37C in a humidified 5% CO 2
   incubator.


5. Stain the cells with the BHQ1-Cy3 probe (final concentration:
   5 μM) and Hoechst 33,342 (final concentration: 1μg/mL) in
   the complete growth medium (50μL) for 5 min at 37Cina
   humidified 5% CO 2 incubator (seeNotes 17and 18 ).


6. Wash the cells with 1PBS, and observe the RNA targets
   under a confocal microscope (seeNote 16).

4 Notes

1. A 5 w/v % solution in DMSO is prepared before use.


2. A 25 v/v % solution in CH 2 Cl 2 is prepared immediately before
   use.


3. We used DMT-MM as a coupling reagent, but other water-
   soluble coupling reagents can be used.


4. Fmoc-β-Ala-Wang Resin should be swelled in DMF prior to
   the coupling reactions.

5 ’ 3 ’

3’ 5’

GGAGCAATGATGGCCTAGATAAATTCGGAGCTTGATCTTCATTTTTTT

CCTCGTTACTACCGGATCTATTTAAGCCTCGAACTAGAAGTAAAAAAA

mRNA-targeting

aptamer sequence

pSuper RNA polymerase III

transcriptional terminator

Fig. 3Design and construction of an expression vector encoding the RT-aptamer

Live-Cell RNA Imaging with a Small Molecule 315