Article
Methods
Cell culture
Cells were grown and maintained in a humidified incubator at 37 °C and
5% CO 2. LMR7.5 T cell hybridomas, a gift from A. M. Lennon-Duménil
(Institut Curie, Paris, France), were cultivated in R10 medium (RPMI
1640 supplemented with 10% FBS, 2 mM l-glutamine, 100 units/ml
penicillin, 100 μg/ml streptomycin and 50 μM 2-mercaptoethanol;
Gibco, Thermo Fisher Scientific). The Lifeact-GFP^24 parental T cell line
was generated by nucleofection with an eGFP reporter construct (Kit V,
Lonza). Alternatively, LMR T cells were infected with a plasmid encod-
ing Lifeact-mCherry (pLenti6.3, Invitrogen, Thermo Fisher Scientific).
LX-293 HEK cells (Clontech) were used for lentivirus production and
maintained in D10 medium (DMEM with 2 mM l-glutamine, 10% FBS,
and 100 units/ml penicillin and 100 μg/ml streptomycin; Gibco). All cell
lines were mycoplasma-free and frequently tested. Neutrophil-like PLB-
985 cells were obtained from the DSMZ (ACC 139). In brief, cells were
maintained in RPMI 1640, supplemented with 10% FBS, 20 mM HEPES
and 1% glutamine (all Gibco, Thermo Fisher Scientific). For differentia-
tion, PLB cells were kept for 6 days in medium containing 1.25% DMSO
(cell culture grade; Sigma-Aldrich). Differentiation status was validated
using flow cytometry (CD11b, Miltenyi Biotec). Before experimenta-
tion, differentiated cells were washed three times to remove DMSO.
Dendritic cells were differentiated from bone marrow that originated
from 6–12-week-old male or female C57BL/6J mice^25. Primary mouse
T cells were obtained from peripheral lymph nodes and spleens^8 and
homogenized with a 70-μm cell strainer. Untouched primary naive
T cells were isolated from 6–12-week-old male C57BL/6J Lifeact-GFP
mice with an EasySep Mouse T cell Isolation Kit according to the manu-
facturer’s protocol (19851 A, STEMCELL Technologies) and incubated
overnight at 37 °C in 5% CO 2 in R10 medium.
Animals
Mice were bred and maintained at the local animal facility in accordance
with the IST Austria ethics commission and the Austrian law. Permis-
sion was granted by the Austrian Federal Ministry of Science, Research
and Economy (identification code: BMWF-66.018/0005-II/3b/2012).
Reporter and CRISPR–Cas9 cell line generation
CRISPR–Cas9 design and production. Single-guide RNAs (sgRNAs)
were designed as described elsewhere^26. In brief, sgRNAs were designed
to induce the double-strand break in the first exons of the mouse gene
encoding talin 1 (Tln1). Then sgRNAs were scored for high on-target
effects (https://portals.broadinstitute.org/gpp/public/analysis-tools/
sgrna-design) and low off-target effects (http://crispr.mit.edu). sgRNAs
were cloned into the LentiCRISPRv1 vector (a gift from F. Zhang, Ad-
dgene plasmid no. 49535). Guide sequences: sgRNA-Scramble s(5′–3′)
GCCGTGGCGCATGGGTAGCA; sgRNA-Talin1g1 s(5′–3′) ATAATGCCCTAC
GAGCCGT (off-target score of 91); sgRNA-Talin1g2 s(5′–3′) CTCACT
GTTTCCCCGGGTA (off-target score of 82); sgRNA-Talin1g3 s(5′–3′)
GTCGAGGCTGGGCGACTGG (off-target score of 98).
Lentivirus production. Lentivirus production was performed as
described previously^25. In brief, LX-293 HEK cells (Clontech) were
co-transfected with LentiCRISPRv1 or LentiCRISPRv2, packaging- ps-
PAX2 (Addgene no. 12260) and pCMV-VSV-G envelope plasmids using
Lipofectamine 2000 (Thermo Fisher Scientific) as recommended by the
manufacturer, and cells were resuspended in R10 medium 1 day before
transfection. Supernatant was collected after 72 h and stored at −80 °C.
CRISPR-based talin KO. Lifeact-eGFP LMR7.5 T cells were spin-infected
at 1,500g for 1 h in the presence of the lentivirus-containing supernatant
and 6 μg/ml Polybrene (Sigma-Aldrich). Spin infection was carried out in
12-well plates with 3 × 10^5 cells/ml per reaction plus 500 μl of undiluted
virus. Three days after infection, cells were selected for stable virus
insertion using 5 μg/ml puromycin (Gibco, Thermo Fisher Scientific) for
7 days and were subjected to western blotting. Cells were then cloned
using fluorescence-activated cell sorting (FACS Aria III, BD Biosciences)
and expanded in R10 medium containing puromycin (5 μg/ml).T cell infection and selection. For infection of LMR7.5 T cells with
the Lifeact-mCherry reporter construct, the same infection protocol
was applied except cells were selected with 5 μg/ml blasticidin (Gibco,
Thermo Fisher Scientific) and sorted for fluorescence.Western blot
For immunodetection of talin and GAPDH proteins, 1 × 10^6 control and
talin-KO cells were centrifuged and lysed in RIPA buffer (New England
Biolabs) and the supernatant was denatured in 2× Laemmli buffer
(161-0737, Bio-Rad,) at 95 °C for 5 min. Protein lysates were loaded on
a 10% Tris-glycine gel (Invitrogen, Thermo Fisher Scientific), sepa-
rated by SDS–PAGE and further transferred by electrophoresis to a
polyvinylidene difluoride membrane (iBlot, Invitrogen, Thermo Fisher
Scientific) according to the manufacturer’s instructions, with a 9-min
transfer time. Membranes were blocked in PBST-BSA 5% for 1 h and incu-
bated with primary antibodies overnight at 4 °C. Antibodies to talin
(mouse anti-pan-talin, clone 8d4; T3287, Sigma-Aldrich) and GAPDH
(mouse, clone GA1R; ab125247, Abcam) were diluted 1:200 and 1:3,000 in
PBST-BSA 1%, respectively. After washing with TBST, secondary antibody
was applied for 1 h in PBST-BSA 5% at room temperature (goat anti-mouse
IgG HRP conjugate, diluted 1:5,000; 170-6516, Bio-Rad). Protein detec-
tion was performed by enhanced chemiluminescence (ECL; Thermo
Fisher Scientific) detection using a VersaDoc imaging system (Bio-Rad).Adhesion assay
Control and talin-KO T cells (5 × 10^5 ) were plated in pre-warmed R10
medium in a 25-cm^2 culture flask (TPP, Sigma-Aldrich) and placed in
a humidified incubator at 37 °C, 5% CO 2 for 24 h before observation.
Cells were imaged with an inverted microscope at low magnification
(DM IL Led and DFC450 digital camera, Leica Microsystems) and cells
adhering to the bottom of the dish were counted manually.Spreading assay
The 2D spreading assay was performed on glass coverslips
(Menzel-Glaser no. 1, VWR) that were previously coated with 2 μg/ml
of recombinant mouse ICAM-1/human Fc chimaera (796-IC, R&D
Systems) overnight at 4 °C, and washed three times with PBS. Con-
trol (Lifeact-mCherry or Lifeact-GFP) and talin-KO (Lifeact-GFP or
Lifeact-mCherry) T cells (0.2 × 10^6 ) were gently mixed in 200 μl R10
medium and allowed to settle on the coated dish for 60 min at 37 °C
and 4.5% CO 2. Cell spreading was then imaged by simultaneous TIRF
and epifluorescence microscopy.Photolithography
Photolithography was performed as previously described^13 ,^25 ,^27 ,^28 with
the following adaptations.Photomasks. Patterns were designed with Coreldraw X8 (Corel Cor-
poration) exported to DXF, then converted to GERBER format with
LinkCad. Chrome photomasks (100 mm or 125 mm; PhotoData/JD
Photo-Tools) were used.Confiners. The 3-μm confiner masters were produced by spin-coating
SU8-GM1050 (Gersteltec) for 40 s at 3,000 rpm, pre-baking for 1 min at
120 °C, exposing to 35 mJ/cm^2 of UV, post-exposure baking for 5 min at
95 °C, developing in SU8 developer, and then hard-baking at 150 °C for
5 min. The 5-μm confiner master was produced by spin-coating SU8-
2005 (Microchem) for 30 s at 3,000 rpm, pre-baking for 2 min at 95 °C,
exposing to 105 mJ/cm^2 of UV, post-exposure baking for 3 min at 95 °C,
developing in SU8 developer, and then hard-baking at 150 °C for 5 min.