RNA Detection

containing tagged RBPs can be immunoprecipitated using antibodies directed against selected protein tags. Brain tissues are high ...

Ultracentrifuge. Swing-out rotor (e.g., Beckmann SW41). OptiPrep: 60 w/v % solution of iodixanol in dH 2 O (sterile) (e.g., Sig ...

Add 1 mL 40 mM DMP (seeNote 3) in TEA to the beads (cross-linking step). Incubate at RT for 30 min, constantly rotating. Wash b ...

3.4 Immuno- precipitation of RNPs Pool OptiPrep fractions, which show an enrichment of the protein of interest (in our case Sta ...

To block the beads, add 400μL blocking solution to 50μL Ab- or PIS-coupled beads and incubate at 4C for 1 h constantly rotatin ...

Different RBPs behave differently during or upon lysis. For every protein, lysis conditions have to be optimized. Impor- tantly ...

RNAs. Cell Rep 5:1511–1518. doi:10.1016/j. celrep.2013.11.039 Fritzsche R, Karra D, Bennett KL et al (2013) Interactome of two ...

Chapter 29 Individual Nucleotide Resolution UV Cross-Linking and Immunoprecipitation (iCLIP) to Determine Protein–RNA Interactio ...

RBPs contributes to various disease etiologies [1, 7–9]. Accord- ingly, RBPs have attracted considerable interest in recent year ...

Table 1 Variants of UV cross-linking and immunoprecipitation Method Difference Advantage Disadvantages References CLIP Initial C ...

that may be of interest, allow accurate isolation of RNAs that are of suitable length for library construction, and to provide a ...

aatgatacggcgaccaccgagatctacactctttcccta CACGACGCTCTTCCGATCT gtccttacggctctggctagagcatacgg cagaagacgaac TCTAGCCTTCTCGCCAAGTC RBP ...

with experimental design alongside the current chapter. In the described protocol we additionally incorporate the use of a non- ...

Thermocycler. qPCR machine. 1.5/2 mL tube thermomixer. 1.5 mL centrifuge. Vacuum pump. Sonicator. Magnetic rack. Acetate printi ...

Sodium deoxycholate. Urea. EDTA pH 8.0. MgCl 2. Tween 20. Dithiothreitol. PEG400. LDS-4sample buffer. Methanol. 20MOPS-SDS ru ...

Low molecular DNA weight marker (e.g., NEB). SYBR safe. Circligase II, MnCl 2 , and 10buffer. Fast Digest BamH1. PCR mastermix ...

PK Buffer: 100 mM Tris–HCl, pH 7.4, 50 mM NaCl, and 10 mM EDTA. Sterile filter and store at 4C. PK Buffer +7 M Urea: 100 mM Tr ...

Place plate on ice-filled tray which has dimensions suitable for UV cross-linker (seeNote 5). Ensure that cell culture dish lid ...

Prepare a 1/1000 dilution of RNase I in 500μL of ice-cold lysis buffer. This dilution is used for low RNase samples (see Note 1 ...

Wash with 1PNK buffer. Wash with 1high salt wash buffer. Rotate the wash for 5 min in the cold room. Wash with 2PNK buffer a ...