Quorum Sensing
4 Notes 1.S-adenosyl-L-methioninep-toluenesulfonate salt may also be used in place of chloride salt. The tosylate salt usually i ...
The change in extinction coefficient between intact and cleaved C-S bond is 4000 M^1 cm^1. For instance, in a 20 units/ml xan ...
BmaI1 acylhomoserine lactone synthase. Bio- chemistry 53:6231–6242 Gould TA, Schweizer HP, Churchill MEA (2002) Structure of th ...
Chapter 14 Global Expression Analysis of Quorum Sensing-Controlled Genes by RNAseq Charlotte D. Majerczyk Abstract RNA sequencin ...
said, microarrays are still useful in the identification of differentially regulated genes—depending on one’s experimental desig ...
Another approach to identify QS-controlled genes is performing “signal add-back” experiments. In this method, sam- ples from two ...
This chapter focuses on RNAseq using NSR primers. This protocol was used to identify QS-controlled genes in three related Burkho ...
Agarose. Electrophoresis apparatus. PCR machine and tubes. A primer set (Forward and Reverse) for a gene in your organism. PCR ...
(b) FwdAD-AAC (GTTAGATCGGAAGAGCGTAATGATA CGGCGACCACCGACACTCTTTCCCTACACGACG CTCTTCCGATCTAAC) (c) FwdAD-CGA (TCGAGATCGGAAGAGCGTAAT ...
containing 50μlRLT+βME. Centrifuge the tube at max speed for 30 s. Then, transfer 750μl to a fresh 2 ml microfuge tube. Add 1.1 ...
Digest away the DNA in the RNA sample by mixing in a tube on ice: 10μg RNA, 10μl10TURBO DNase Buffer, 2μl TURBO DNase, and RNa ...
stock can be stored indefinitely at 20 C and does not need to be remade with each library construction. For First Strand Synt ...
Fig. 2Overview of RNAseq library synthesis. (a) For First Strand Synthesis, untailed hexamers (NSR Primers) and SuperScript III ...
premix to the sample/adapter mix, and incubate at 23C for 15 min (seeNote8) (Fig.2d). To fill-in and PCR amplify each ligation ...
to 1000 base pairs with most falling below 500 base pairs. Figure3 shows four representative samples. If pooling samples, bring ...
is left behind, it will interfere with downstream processes (such as RNA isolation and gDNA digestion of the RNA sample). To pr ...
This protocol was developed for use with not-so-random (NSR) primers. NSR primers can be designed for your organ- ism(s) of int ...
barcoded. The reverse adapter (RevAD) is never barcoded. The stem-loop adapters are engineered each with a 3-base barcode tag to ...
References Schuster M (2011) Global expression analysis of quorum-sensing controlled genes. Methods Mol Biol 692:173–187 Armour ...
Chapter 15 Identification of AHL- and BDSF-Controlled Proteins inBurkholderia cenocepaciaby Proteomics Yilei Liu, Gabriella Pess ...
«
5
6
7
8
9
10
11
12
13
14
»
Free download pdf