Nature - USA (2019-07-18)
Letter reSeArCH Dee, D. P. et al. The ERA-interim reanalysis: configuration and performance of the data assimilation system. Q. ...
reSeArCH Letter Extended Data Fig. 1 | 1908–1941 SST trends in major observational estimates and CMIP5 simulations. a–d, Maps of ...
Letter reSeArCH SST offsets ( oC) -0.4 -0.2 0 0.2 0.4 c 103 104 105 Deck 156 DE Deck 192 JP Kobe decks Year 19101915 1920 192519 ...
reSeArCH Letter 0 0.5 1 a 0 50 100 0 1 2 3 Decimal ( o C) 0 0.5 1 b 0 50 100 Percentageo f SSTs at whole degrees Number of measu ...
Letter reSeArCH Extended Data Fig. 4 | Sensitivity of 1908–1941 SST trends. As for Fig. 3 , but with Japanese Kobe Collection d ...
reSeArCH Letter Extended Data Fig. 5 | Comparison of SSTs with coastal air temperature estimates. a, b, Air temperatures are fro ...
Letter reSeArCH Extended Data Fig. 6 | Sea level pressure and the Pacific Decadal Oscillation. a, Spatial pattern of sea level p ...
reSeArCH Letter a o N N S S b S.d. of trend ( oC/34 years) 0 0.05 0.1 0.15 0.2 60 oE 120 oE 180 oW 120 oW 60 oW 0 o c S S N N o ...
Letter reSeArCH c 0 o 30 oN 60 oN 30 oS d 60 oE 120 oE 180 oW 120 oW 60 oW 0 o e 60 oS 30 oS 0 o 60 oN 30 oN 60 oE 120 oE 180 oW ...
reSeArCH Letter Year 1860 1880 1900 1920 1940 1960 1980 2000 Number of bucket measurements x10 5 0 2 4 6 8 10 12 0 20 40 60 80 1 ...
Letter reSeArCH 100 101 102 103 104 105 Random and ship-level errors for averaged SST differences ( oC 2 ) 10 -4 10 -3 10 -2 10 ...
Letter https://doi.org/10.1038/s41586-019-1383-0 Notum produced by Paneth cells attenuates regeneration of aged intestinal epith ...
Letter reSeArCH organoid formation by young Lgr5hi cells. These data indicate that both stem-cell-intrinsic and -extrinsic epith ...
reSeArCH Letter rapamycin-treated mice (Extended Data Fig. 5j), possibly also reflect- ing an increase in the number of Paneth c ...
Letter reSeArCH recovered fully within 5 days of this dose, but old mice did not recover (Extended Data Fig. 9a). When Notum act ...
reSeArCH Letter Barker, N. et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449 , 1 ...
Letter reSeArCH Methods Isolation of mouse small-intestinal crypts. Mouse small-intestinal crypts were isolated as previously de ...
reSeArCH Letter ATGAAGCAGGCCGTAGGAC, CTTCTCCTTGAGGGCATCG; Rnf43, CACCAT AGCAGACCGGATCC, TATAGCCAGGGGTCCACACA; Sox9, GAGCCG GATCT ...
Letter reSeArCH intestinal organoids cultured with 4-OHT to generate zsGreen+ wild-type, zsGreen+ knockout, tdTomato+ wild-type ...
reSeArCH Letter Frequency of Ki67+ cells CBCTA cells 0.0 0.4 0.6 0.64 0.83 a j Crypts per organoid Primary culture (^13467891011 ...
«
6
7
8
9
10
11
12
13
14
15
»
Free download pdf