Nature 2020 01 30 Part.02

Nature | Vol 577 | 30 January 2020 | 689 Article VEGF-C-driven lymphatic drainage enables immunosurveillance of brain tumours Er ...

690 | Nature | Vol 577 | 30 January 2020 Article Glioblastoma is devoid of lymphangiogenic signals Previous studies have shown t ...

Nature | Vol 577 | 30 January 2020 | 691 VEGFC mRNA construct shows peak expression after 24 h, whereas the expression of AAV-VE ...

692 | Nature | Vol 577 | 30 January 2020 Article the phenotypes of T cells that infiltrate the brain (Fig. 3e, Extended Data Fig ...

Nature | Vol 577 | 30 January 2020 | 693 tumours (Fig. 4a, b). Similar results were observed with the B16 cell line (Extended Da ...

694 | Nature | Vol 577 | 30 January 2020 Article Online content Any methods, additional references, Nature Research reporting su ...

Methods Mice Four- to-eight-week-old mixed sex C57BL/6 mice, B6.129S2-IghtmICgn/ J (μMT) mice and B6.SJL-PtprcaPepcb/BoyCrl mice ...

Article Tumour inoculation Mice were anaesthetized using a mixture of ketamine (50 mg kg−1) and xylazine (5 mg kg−1), injected i ...

For AKT phosphorylation staining, surface markers were first stained on ice for 30 min. Cells were then fixed and washed followi ...

Article 50,000 GL261 Luc cells Day 7 post tumor inoculation Day 14 Day 21-28 050 100 150 200 0 20 40 60 80 100 Days Percent surv ...

ab 0500 1000 1500 2000 2500 0 20 40 60 80 100 Days Percent survival VEGF-C low VEGF-C hi VEGF-C lo w VEGF-C hi 0 1 2 3 4 5 6 7 8 ...

Article Cy5-mRNA JETPEI 1 2 3 (^124) 34 acccagtccgcgcgaggcgcccgccaccgtcgccgcatgcacttgctgtgcttcttgtctctggcgtgttccctgccttcgagtcggg ...

0 20 40 60 80 100 (^0) -10 4 0 104 105106 20 40 60 80 100 (^0) -10 4 0 104 105106 20 40 60 80 100 -10^40104105106 (^200) 40 60 8 ...

Article Extended Data Fig. 4 | VEGF-C signals specif ically in lymphatic endothelial cells in the meninges and deep cervical lym ...

a VEGF-C-mRNA/GFP-mRNA Intracisternal injection Lymph Node Tumor GFP-mRNA VEGF-C-mRNA GFP-mRNA VEGF-C-mRNA 103 104 105 106 107 # ...

Article Brain Tumor 0 50 100 150 Mean ER V a row min row max id SRR579545 (b6J)SRR579546 (b6J)SRR2927735 (b6J)SRR594402 (b6J)SRR ...

Extended Data Fig. 7 | See next page for caption. ...

Article Extended Data Fig. 7 | VEGF-C-dependent anti-PD-1 potentiation is specif ic to VEGF-C among proteins of the VEGF family, ...

a Luc-mRNAVEGF-C-mRNA (^103791113) 10104 1056 10107 8 Days Cell numbe rMeninges macrophage (^103791113) 10104 1056 10107 8 Days ...

Article a SSC-AFSC-A FSC-WFSC-H SSC-WSSC-H LivCD45-PE-Cy7 e/dead-AmCya n CD3-BCD45-PE-Cy7 UV737 CD4-BV496CD8-BUV395 CD3-BCD44-A7 ...