Nucleic Acids in Chemistry and Biology

148 Chapter 4 5
-unit to yield a dinucleoside phosphodiester. The main drawback is that the product phosphodiester is also vuln ...

Synthesis of Oligonucleotides 149 4.1.3.3 Phosphite Triester. The development of phosphite triester (or phosphoramidite) chemist ...

150 Chapter 4 pivaloyl chloride), which couples the H-phosphonate diester to a nucleoside hydroxyl group (Figure 4.9). The resul ...

Synthesis of Oligonucleotides 151 sites) are beyond the scope of this Chapter. It is sufficient to note that a long spacer is us ...

152 Chapter 4 This cycle is repeated the requisite number of times for the length of the oligonucleotide required, with each deo ...

Synthesis of Oligonucleotides 153 4.1.4.4 Purification of the Oligonucleotides. The average yield for each step during an oligon ...

154 Chapter 4 B DMTO O OO NCCH 2 CH 2 O P N O Si O NCCH 2 CH 2 O P N B DMTO O O B O O O O O O O O O MeO P N Si O O O a 2'-TBDMS ...

Synthesis of Oligonucleotides 155 can be removed by treatment with fluoride ion at the end of assembly (Section 4.2.2). TBDMS ch ...

156 Chapter 4 5’-p*TAATACGACTACATATAGGGAGA 3’-ATTATGCTGAGTGATATCCCTCTYTCAG dXTP 5’-p*TAATACGACTACATATAGGGAGAX 3’-ATTATGCTGAGTGAT ...

Synthesis of Oligonucleotides 157 4.3.2 Enzymatic Synthesis of Oligoribonucleotides 4.3.2.1 Transcription by T7 RNA Polymerase. ...

158 Chapter 4 carries no terminal phosphate whereas the donor is phosphorylated at both ends. The 3
-phosphate of the donor acts ...

Synthesis of Oligonucleotides 159 4.4.2 Modifications of the 5

- and 3

-Termini There are a number of reagents useful for atta ...

160 Chapter 4 Stereochemistry at a thiophosphate is defined according to the CIP convention with priority SO3
O5
O(P). Oli ...

Synthesis of Oligonucleotides 161 phosphorothioate-modified oligodeoxynucleotides with mixed phosphorothioate stereochemistry bi ...

162 Chapter 4 4.4.3.4 Phosphoramidates. Phosphoramidatesare internucleotide linkages in which either the 3
- or 5
-oxygen of th ...

Synthesis of Oligonucleotides 163 ribose conformation (see Section 2.1.1). In contrast to RNA, there is a considerable increase ...

164 Chapter 4 N O R5'O Base ONRP 2 OR3' Morpholino phosphorodiamidate nucleoside Figure 4.26 Structure of a morpholino phosphoro ...

Synthesis of Oligonucleotides 165 by an amino group to give a phosphorodiamidate morpholino (PMO) linkage (Figure 4.26). This ty ...

C. Leumann, DNA analogues: from supramolecular principles to biological properties. Bioorg. Med. Chem., 2002, 10 , 841–854. R.P ...

CHAPTER 5 Nucleic Acids in Biotechnology CONTENTS 5.1 DNA Sequence Determination 168 5.1.1 Principles of DNA Sequencin g168 5.1. ...